Miyakogusa Predicted Gene

Lj0g3v0294529.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0294529.1 tr|G8XS16|G8XS16_9ASTR Homogentisate
phytylprenyltransferase OS=Artemisia sphaerocephala PE=2
SV=1,54.02,8e-19,UbiA,UbiA prenyltransferase family;
BACTERIOCHLOROPHYLL SYNTHASE,NULL;
PRENYLTRANSFERASES,NULL,TC67425.path1.1
         (354 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67425 similar to UniRef100_Q1ACB2 Cluster: Homogentis...   214   3e-55
gnl|LJGI|AV409197 similar to UniRef100_Q1ACB2 Cluster: Homogenti...    96   2e-19

>gnl|LJGI|TC67425 similar to UniRef100_Q1ACB2 Cluster: Homogentisate
           phytyltransferase VTE2-2; n=1; Glycine max|Rep:
           Homogentisate phytyltransferase VTE2-2 - Glycine max
           (Soybean), partial (86%)
          Length = 1493

 Score =  214 bits (108), Expect = 3e-55
 Identities = 207/240 (86%)
 Strand = Plus / Plus

                                                                       
Query: 4   aagtggtctttttggttcaaagcagtctccactctttttgccctgctttgtgcgaatatt 63
           ||||||||| ||  |||||||||| ||||   ||||||||||||| |||||| ||||  |
Sbjct: 403 aagtggtctcttgtgttcaaagcactctctggtctttttgccctgatttgtgggaatggt 462

                                                                       
Query: 64  tatatagttggcatcaatcaaatctatgacattagtgttgacaagataaacaaacctcat 123
           |||||||||||||||||||||||||||||||||||| |||||||| ||||||| ||| ||
Sbjct: 463 tatatagttggcatcaatcaaatctatgacattagtattgacaaggtaaacaagccttat 522

                                                                       
Query: 124 ttaccaatagcttcaggagaaatttctgttcgtttagcatggctcttggttatatatttc 183
           ||||| |||||| |||||||  |||||||  |||  ||||||||||||||||||| ||||
Sbjct: 523 ttacctatagctgcaggagatctttctgtcagttctgcatggctcttggttatatttttc 582

                                                                       
Query: 184 acagcagctggcttgttggtcgtaggattcacctccgggcccttacttttttctctttac 243
            ||||||||||||||||| | |||||||| | ||  ||||||||  ||||||||||||||
Sbjct: 583 gcagcagctggcttgttgattgtaggattgaactttgggccctttattttttctctttac 642



 Score = 83.8 bits (42), Expect = 7e-16
 Identities = 57/62 (91%)
 Strand = Plus / Plus

                                                                       
Query: 293 atgaaacgctttccagttgcagcattacttattattgccacgacacggggtgttctactt 352
           |||||||||||||||||||||||||| |||||||||||||||   |||||| ||||||||
Sbjct: 691 atgaaacgctttccagttgcagcatttcttattattgccacggttcggggttttctactt 750

             
Query: 353 aa 354
           ||
Sbjct: 751 aa 752


>gnl|LJGI|AV409197 similar to UniRef100_Q1ACB2 Cluster: Homogentisate
           phytyltransferase VTE2-2; n=1; Glycine max|Rep:
           Homogentisate phytyltransferase VTE2-2 - Glycine max
           (Soybean), partial (22%)
          Length = 309

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 4   aagtggtctttttggttcaaagcagtctccactctttttgccctgctttgtgcgaatatt 63
           ||||||||| ||  |||||||||| ||||   ||||||||||||| |||||| ||||  |
Sbjct: 218 aagtggtctcttgtgttcaaagcactctctggtctttttgccctgatttgtgggaatggt 277

                                           
Query: 64  tatatagttggcatcaatcaaatctatgacat 95
           ||||||||||||||||||||||||||||||||
Sbjct: 278 tatatagttggcatcaatcaaatctatgacat 309