Miyakogusa Predicted Gene

Lj0g3v0287339.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0287339.1 Non Chatacterized Hit- tr|I1LLS0|I1LLS0_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,81.71,0,coiled-coil,NULL; FAMILY NOT NAMED,NULL; DUF260,Lateral
organ boundaries, LOB; seg,NULL; LOB,Lateral,CUFF.19194.1
         (528 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72156 homologue to UniRef100_Q9SHE9 Cluster: LOB doma...    80   2e-14
gnl|LJGI|FS328199 similar to UniRef100_Q9SHE9 Cluster: LOB domai...    62   4e-09

>gnl|LJGI|TC72156 homologue to UniRef100_Q9SHE9 Cluster: LOB domain-containing
           protein 4; n=1; Arabidopsis thaliana|Rep: LOB
           domain-containing protein 4 - Arabidopsis thaliana
           (Mouse-ear cress), partial (67%)
          Length = 945

 Score = 79.8 bits (40), Expect = 2e-14
 Identities = 130/160 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 aagtttgccattgtgcataaggtctttggtgctagcaatatcagcaaaatgctgcaggag 159
           |||||||| | |||||| || || |||||||| |||||| ||| ||| ||||| ||||| 
Sbjct: 174 aagtttgctaatgtgcacaaagtatttggtgccagcaatgtcaacaagatgcttcaggac 233

                                                                       
Query: 160 cttccagttcatcaaagagcagatgctgtgagcagtttagtattcgaggcaaatgcaaga 219
            | ||||  ||||| ||||  ||||||||||||||  | || |  |||||||||||||||
Sbjct: 234 ttaccagagcatcagagaggggatgctgtgagcagcatggtgtatgaggcaaatgcaaga 293

                                                   
Query: 220 gtgagagaccctgtttatggttgtgttggagccatatcat 259
           ||||| |||||||| ||||| ||||| || ||||| ||||
Sbjct: 294 gtgagggaccctgtgtatggctgtgtaggtgccatttcat 333


>gnl|LJGI|FS328199 similar to UniRef100_Q9SHE9 Cluster: LOB domain-containing protein
           4; n=1; Arabidopsis thaliana|Rep: LOB domain-containing
           protein 4 - Arabidopsis thaliana (Mouse-ear cress),
           partial (38%)
          Length = 699

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 205 gaggcaaatgcaagagtgagagaccctgtttatggttgtgttggagccatatcat 259
           |||||||||||||||||||| |||||||| ||||| ||||| || ||||| ||||
Sbjct: 326 gaggcaaatgcaagagtgagggaccctgtgtatggctgtgtaggtgccatttcat 272