Miyakogusa Predicted Gene

Lj0g3v0286449.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0286449.1 Non Chatacterized Hit- tr|I1KUZ2|I1KUZ2_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max PE=3,72.42,0,no
description,NULL; seg,NULL; PROTEIN_KINASE_DOM,Protein kinase,
catalytic domain; LEURICHRPT,NULL;,CUFF.19112.1
         (1914 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinas...    54   3e-06

>gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinase-like protein; n=1;
            Glycine max|Rep: Pti1 kinase-like protein - Glycine max
            (Soybean), complete
          Length = 1554

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 1531 aaaagtgatgtttacagctttggagttgttcttctggaa 1569
            ||||||||||||||||| ||||||||||| ||| |||||
Sbjct: 937  aaaagtgatgtttacagttttggagttgtacttttggaa 975