Miyakogusa Predicted Gene

Lj0g3v0286159.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0286159.1 Non Chatacterized Hit- tr|I1L775|I1L775_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,58.33,0.000000000004,no description,Nucleotide-binding,
alpha-beta plait; coiled-coil,NULL; RNA-binding domain,
RBD,NULL;,CUFF.19089.1
         (687 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP048490 similar to UniRef100_Q40363 Cluster: NuM1 prot...    58   8e-08

>gnl|LJGI|BP048490 similar to UniRef100_Q40363 Cluster: NuM1 protein; n=1; Medicago
           sativa|Rep: NuM1 protein - Medicago sativa (Alfalfa),
           partial (16%)
          Length = 452

 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 637 ttcaaagattgtggagaagttgttgatgt 665
           |||||||||||||||||||||||||||||
Sbjct: 402 ttcaaagattgtggagaagttgttgatgt 430