Miyakogusa Predicted Gene
- Lj0g3v0285959.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0285959.1 tr|E2FKJ1|E2FKJ1_MEDTR Sieve element occlusion by
forisomes 2 OS=Medicago truncatula GN=SEO-F2 PE=2
,63.76,0,seg,NULL,CUFF.19131.1
(2031 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS333807 similar to UniRef100_A8C977 Cluster: Forisome;... 86 1e-15
gnl|LJGI|TC61635 similar to UniRef100_A8C977 Cluster: Forisome; ... 68 2e-10
>gnl|LJGI|FS333807 similar to UniRef100_A8C977 Cluster: Forisome; n=1; Vicia faba|Rep:
Forisome - Vicia faba (Broad bean), partial (30%)
Length = 765
Score = 85.7 bits (43), Expect = 1e-15
Identities = 76/87 (87%)
Strand = Plus / Plus
Query: 333 aacaatatggattctccagcagctgagaagcttctcctgggatgcaaaagcactgatagc 392
|||||| |||||||| || | |||||||||| ||||||||||||||||||| | ||| |
Sbjct: 369 aacaatgtggattcttcaaaacctgagaagctactcctgggatgcaaaagcaatcataac 428
Query: 393 tctagctgctttcactttggaatatgg 419
||||||||||||||| ||||| |||||
Sbjct: 429 tctagctgctttcaccttggagtatgg 455
>gnl|LJGI|TC61635 similar to UniRef100_A8C977 Cluster: Forisome; n=1; Vicia faba|Rep:
Forisome - Vicia faba (Broad bean), partial (42%)
Length = 1131
Score = 67.9 bits (34), Expect = 2e-10
Identities = 55/62 (88%)
Strand = Plus / Plus
Query: 1951 tgtggccgtgtgatggaggttacctctgtcaattacaggtgctgccaccatgatgatcca 2010
|||||||||||||||||||| || ||||| ||||||| |||||||||| ||||| ||||
Sbjct: 843 tgtggccgtgtgatggaggtgacttctgttaattacaagtgctgccacagtgatgctcca 902
Query: 2011 aa 2012
||
Sbjct: 903 aa 904