Miyakogusa Predicted Gene
- Lj0g3v0285839.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0285839.1 Non Chatacterized Hit- tr|I3S6M1|I3S6M1_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=2
SV,62.57,0,K-box,Transcription factor, K-box; MADS BOX PROTEIN,NULL;
seg,NULL; coiled-coil,NULL; K_BOX,Transcri,CUFF.19066.1
(513 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO037100 homologue to UniRef100_A0EIX6 Cluster: Transcr... 84 1e-15
gnl|LJGI|BP067878 similar to UniRef100_A1XG54 Cluster: SOC1; n=1... 58 6e-08
>gnl|LJGI|GO037100 homologue to UniRef100_A0EIX6 Cluster: Transcription factor AGL20;
n=1; Ipomoea batatas|Rep: Transcription factor AGL20 -
Ipomoea batatas (Sweet potato) (Batate), partial (33%)
Length = 371
Score = 83.8 bits (42), Expect = 1e-15
Identities = 42/42 (100%)
Strand = Plus / Plus
Query: 1 atgctggagtcaattgaacgataccgcaaacataccaggaat 42
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 atgctggagtcaattgaacgataccgcaaacataccaggaat 371
>gnl|LJGI|BP067878 similar to UniRef100_A1XG54 Cluster: SOC1; n=1; Glycine max|Rep:
SOC1 - Glycine max (Soybean), partial (34%)
Length = 395
Score = 58.0 bits (29), Expect = 6e-08
Identities = 59/69 (85%)
Strand = Plus / Minus
Query: 269 ttgagcaactaaaagaaaaggaaaaagtgctagtggcagaaaactccaggctctctgaga 328
|||||||||||||||| ||||||||||| ||| | || ||||| |||| ||| |||||
Sbjct: 353 ttgagcaactaaaagagaaggaaaaagtcctacttgctgaaaatgccagactcactgagc 294
Query: 329 agtatggta 337
|||||||||
Sbjct: 293 agtatggta 285
Score = 52.0 bits (26), Expect = 3e-06
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 415 tatggtgaaagtagttcaagttcagatgtggagactgaattgttcattgg 464
|||| |||||| ||| | ||||||||||| || |||||||||||||||||
Sbjct: 240 tatgctgaaagcagtcccagttcagatgtagaaactgaattgttcattgg 191