Miyakogusa Predicted Gene

Lj0g3v0285449.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0285449.1 tr|G7I6A4|G7I6A4_MEDTR Pentatricopeptide
repeat-containing protein OS=Medicago truncatula
GN=MTR_1g0,28.79,1e-18,PPR: pentatricopeptide repeat
domain,Pentatricopeptide repeat; seg,NULL; no
description,Tetratricope,CUFF.19042.1
         (1373 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO025151                                                     307   1e-82

>gnl|LJGI|GO025151 
          Length = 689

 Score =  307 bits (155), Expect = 1e-82
 Identities = 155/155 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1219 cttgcccaaaagattctttatgagatgatggacaagggtctcaaacctaatttttcagtg 1278
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2    cttgcccaaaagattctttatgagatgatggacaagggtctcaaacctaatttttcagtg 61

                                                                        
Query: 1279 ttcaataaggtaaggaagtgtcttgagaagaaaaatgaaataggtttgtctttggaatta 1338
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62   ttcaataaggtaaggaagtgtcttgagaagaaaaatgaaataggtttgtctttggaatta 121

                                               
Query: 1339 tcaagaagatacttgagcttgattgaaaaatgaag 1373
            |||||||||||||||||||||||||||||||||||
Sbjct: 122  tcaagaagatacttgagcttgattgaaaaatgaag 156