Miyakogusa Predicted Gene
- Lj0g3v0284759.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0284759.1 Non Chatacterized Hit- tr|A2Y503|A2Y503_ORYSI
Putative uncharacterized protein OS=Oryza sativa subsp,64,0.25,
,CUFF.18986.1
(170 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74986 homologue to UniRef100_A7P9D9 Cluster: Chromoso... 66 7e-11
>gnl|LJGI|TC74986 homologue to UniRef100_A7P9D9 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (26%)
Length = 544
Score = 65.9 bits (33), Expect = 7e-11
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 40 agggaaattataaatcacagattaccgaggcatcccaatat 80
|||||||||||||||||||||| || |||||||||||||||
Sbjct: 411 agggaaattataaatcacagatcactgaggcatcccaatat 451