Miyakogusa Predicted Gene

Lj0g3v0284239.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0284239.1 Non Chatacterized Hit- tr|Q4VSY9|Q4VSY9_PINLO
Putative LEA protein (Fragment) OS=Pinus longaeva
GN=i,52.27,9e-19,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
Water Stress and Hypersensitive response,Water stre,CUFF.18941.1
         (459 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66433 similar to UniRef100_P46519 Cluster: Desiccatio...   167   8e-41
gnl|LJGI|TC62315 similar to UniRef100_P46519 Cluster: Desiccatio...   167   8e-41
gnl|LJGI|TC68237 similar to UniRef100_A7PZJ7 Cluster: Chromosome...    54   8e-07

>gnl|LJGI|TC66433 similar to UniRef100_P46519 Cluster: Desiccation protectant protein
           Lea14 homolog; n=1; Glycine max|Rep: Desiccation
           protectant protein Lea14 homolog - Glycine max
           (Soybean), partial (98%)
          Length = 666

 Score =  167 bits (84), Expect = 8e-41
 Identities = 240/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 145 aacccttattccactccaatccccatttgtgagatcaactactctttcaaaagcgccacc 204
           ||||||||||| || || || || || ||||||||||||||| |  ||||||| ||   |
Sbjct: 212 aacccttattcaacaccgattcctatctgtgagatcaactacaccctcaaaagtgctggc 271

                                                                       
Query: 205 agggagatagcatctggaaggataccggaccctggttccttgaaggcgaaggacatgaca 264
           |||||||||||||| || |  ||||| ||||| |||||  ||||||| |  ||||  |||
Sbjct: 272 agggagatagcatcaggcaccataccagacccaggttcactgaaggcaagtgacacaaca 331

                                                                       
Query: 265 atggtgaatgtgccggtgaaggtgccgtacagcatattgatgagcttggcaaaggatatt 324
            || || | ||||||||||||||  |  ||||||||||| ||||| | |||||||| |||
Sbjct: 332 ctgctggaagtgccggtgaaggtagctcacagcatattgctgagcatagcaaaggacatt 391

                                                                       
Query: 325 ggagctgattgggatattgactatcaactggatattggtctggttattgaccttcctgca 384
           || ||||||||||| || ||||||||  ||||||||||||| || |||||||| || |  
Sbjct: 392 ggtgctgattgggacatagactatcatttggatattggtcttgtcattgacctcccagtc 451

                                                               
Query: 385 attggcaacttcaccattcctctttctcacaagggagaggtcaagctaccaa 436
           ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||
Sbjct: 452 attggcaacttcaccattcctctttctcagaagggagagatcaagctcccaa 503


>gnl|LJGI|TC62315 similar to UniRef100_P46519 Cluster: Desiccation protectant protein
           Lea14 homolog; n=1; Glycine max|Rep: Desiccation
           protectant protein Lea14 homolog - Glycine max
           (Soybean), complete
          Length = 702

 Score =  167 bits (84), Expect = 8e-41
 Identities = 240/292 (82%)
 Strand = Plus / Plus

                                                                       
Query: 145 aacccttattccactccaatccccatttgtgagatcaactactctttcaaaagcgccacc 204
           ||||||||||| || || || || || ||||||||||||||| |  ||||||| ||   |
Sbjct: 190 aacccttattcaacaccgattcctatctgtgagatcaactacaccctcaaaagtgctggc 249

                                                                       
Query: 205 agggagatagcatctggaaggataccggaccctggttccttgaaggcgaaggacatgaca 264
           |||||||||||||| || |  ||||| ||||| |||||  ||||||| |  ||||  |||
Sbjct: 250 agggagatagcatcaggcaccataccagacccaggttcactgaaggcaagtgacacaaca 309

                                                                       
Query: 265 atggtgaatgtgccggtgaaggtgccgtacagcatattgatgagcttggcaaaggatatt 324
            || || | ||||||||||||||  |  ||||||||||| ||||| | |||||||| |||
Sbjct: 310 ctgctggaagtgccggtgaaggtagctcacagcatattgctgagcatagcaaaggacatt 369

                                                                       
Query: 325 ggagctgattgggatattgactatcaactggatattggtctggttattgaccttcctgca 384
           || ||||||||||| || ||||||||  ||||||||||||| || |||||||| || |  
Sbjct: 370 ggtgctgattgggacatagactatcatttggatattggtcttgtcattgacctcccagtc 429

                                                               
Query: 385 attggcaacttcaccattcctctttctcacaagggagaggtcaagctaccaa 436
           ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||
Sbjct: 430 attggcaacttcaccattcctctttctcagaagggagagatcaagctcccaa 481


>gnl|LJGI|TC68237 similar to UniRef100_A7PZJ7 Cluster: Chromosome chr15 scaffold_40,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr15 scaffold_40, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (44%)
          Length = 806

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 129 caatgtctctgttcataacccttattccact 159
           |||| ||||||||||||||||||||||||||
Sbjct: 56  caatatctctgttcataacccttattccact 26



 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                     
Query: 5  cgcagttgctgaataaagccaagaact 31
          |||||||||||||||||||||||||||
Sbjct: 87 cgcagttgctgaataaagccaagaact 61