Miyakogusa Predicted Gene

Lj0g3v0283259.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0283259.1 tr|Q6VM17|Q6VM17_MEDTR Metal transport protein
OS=Medicago truncatula GN=ZIP5 PE=2 SV=1,74.24,0,seg,NULL;
Zip,Zinc/iron permease; ZINC/IRON TRANSPORTER, PLANT AND YEAST,NULL;
ZINC/IRON TRANSPORTER,NODE_28925_length_1701_cov_76.436211.path2.1
         (783 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76224 similar to UniRef100_Q93XE7 Cluster: ZIP-like z...   131   7e-30
gnl|LJGI|BP084096 homologue to UniRef100_Q6VM17 Cluster: Metal t...    98   1e-19
gnl|LJGI|TC81513 homologue to UniRef100_Q8LE59 Cluster: Fe(2+) t...    68   9e-11
gnl|LJGI|GO034035 similar to UniRef100_Q2Z1Q1 Cluster: ZIP famil...    56   3e-07

>gnl|LJGI|TC76224 similar to UniRef100_Q93XE7 Cluster: ZIP-like zinc transporter;
           n=1; Thlaspi caerulescens|Rep: ZIP-like zinc transporter
           - Thlaspi caerulescens (Alpine penny-cress) (Thlaspi
           calaminare), partial (30%)
          Length = 452

 Score =  131 bits (66), Expect = 7e-30
 Identities = 129/150 (86%)
 Strand = Plus / Plus

                                                                       
Query: 605 cagaaggcatcttggacgcgttctcagctgggatcttagtgtacatggctctggtggatt 664
           ||||||| || |||||| |||| ||||| ||||| ||||||||||||||| | ||||| |
Sbjct: 220 cagaagggattttggactcgttgtcagcagggattttagtgtacatggctttagtggact 279

                                                                       
Query: 665 taatagctgcggattttcttagcaagagaatgcgttgtgactttaggctgcagatagttt 724
           | |||||||| |||||||| ||||| |||||| ||||| | |||||||||||||||||||
Sbjct: 280 tgatagctgctgattttctcagcaaaagaatgagttgtaattttaggctgcagatagttt 339

                                         
Query: 725 catactgtttgcttttccttggagctggat 754
           | || ||  ||||||||||||| |||||||
Sbjct: 340 cttattgcatgcttttccttggtgctggat 369


>gnl|LJGI|BP084096 homologue to UniRef100_Q6VM17 Cluster: Metal transport protein;
           n=1; Medicago truncatula|Rep: Metal transport protein -
           Medicago, partial (4%)
          Length = 122

 Score = 97.6 bits (49), Expect = 1e-19
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 731 gtttgcttttccttggagctggatcgatgtcttcactagcaatgtgggcatga 783
           |||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 122 gtttgcttttccttggagctggatcgatgtcttcactagccatgtgggcatga 70


>gnl|LJGI|TC81513 homologue to UniRef100_Q8LE59 Cluster: Fe(2+) transport protein 3,
           chloroplast precursor (Fe(II) transport protein 3); n=1;
           Arabidopsis thaliana|Rep: Fe(2+) transport protein 3,
           chloroplast precursor (Fe(II) transport protein 3) -
           Arabidopsis thaliana (Mouse-ear cress), partial (11%)
          Length = 260

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                       
Query: 706 tttaggctgcagatagtttcatactgtttgcttttccttggagctggatcgatgtcttca 765
           |||||||||||||||||||| || ||  ||||||||||||| |||||||  ||||| || 
Sbjct: 60  tttaggctgcagatagtttcttattgcatgcttttccttggtgctggattaatgtcctcg 119

                             
Query: 766 ctagcaatgtgggcatga 783
           || ||||| |||||||||
Sbjct: 120 cttgcaatatgggcatga 137


>gnl|LJGI|GO034035 similar to UniRef100_Q2Z1Q1 Cluster: ZIP family metal transporter;
           n=1; Chengiopanax sciadophylloides|Rep: ZIP family metal
           transporter - Acanthopanax sciadophylloides
           (Koshiabura), partial (11%)
          Length = 210

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 310 cacgtcgtcgtttcacaggttttggaacttgggattgtatcaca 353
           ||||| || ||||||||||| ||||| |||||||||||||||||
Sbjct: 165 cacgttgttgtttcacaggtcttggagcttgggattgtatcaca 208