Miyakogusa Predicted Gene

Lj0g3v0282469.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0282469.1 Non Chatacterized Hit- tr|F6HMY1|F6HMY1_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,27.39,2e-17,DISEASERSIST,Disease resistance protein;
NB-ARC,NB-ARC; TIR,Toll/interleukin-1 receptor homology
(TI,CUFF.18792.1
         (3135 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TI...    88   4e-16
gnl|LJGI|DC595246 weakly similar to UniRef100_A7QHI1 Cluster: Ch...    58   3e-07
gnl|LJGI|DC600092 weakly similar to UniRef100_Q2HVE0 Cluster: Le...    58   3e-07
gnl|LJGI|TC80360 weakly similar to UniRef100_A7QGI5 Cluster: Chr...    58   3e-07
gnl|LJGI|TC67617 weakly similar to UniRef100_A7PPX7 Cluster: Chr...    56   1e-06

>gnl|LJGI|FS333816 weakly similar to UniRef100_A2Q1X9 Cluster: TIR; n=1; Medicago
            truncatula|Rep: TIR - Medicago truncatula (Barrel medic),
            partial (13%)
          Length = 582

 Score = 87.7 bits (44), Expect = 4e-16
 Identities = 110/132 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1425 agataagtctcttataactgtttctaaagacaacaccgtacaaatgcatgatttgataca 1484
            ||||||||||||||||||  |||| ||  |  ||||  || |||||||||| ||| ||||
Sbjct: 152  agataagtctcttataaccctttcaaataaggacacaatagaaatgcatgacttgttaca 211

                                                                        
Query: 1485 agaaatgggttggcaaattgttcgtgaagaatctatgaagcagcctggaaaacgaagtcg 1544
            ||||||||| ||| ||||||||| | |||||||||| ||| | ||||||| |||||||||
Sbjct: 212  agaaatgggatgggaaattgttcatcaagaatctatcaaggatcctggaagacgaagtcg 271

                        
Query: 1545 gttgtgggatcc 1556
             || ||||||||
Sbjct: 272  attatgggatcc 283


>gnl|LJGI|DC595246 weakly similar to UniRef100_A7QHI1 Cluster: Chromosome chr5
           scaffold_98, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr5 scaffold_98, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (11%)
          Length = 434

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 250 tatgcttcttctaagtggtgtttggatgaactccagaagattattgaat 298
           ||||||||||| ||||||||||||||||||||   ||||||||| ||||
Sbjct: 340 tatgcttcttccaagtggtgtttggatgaacttgtgaagattatggaat 388


>gnl|LJGI|DC600092 weakly similar to UniRef100_Q2HVE0 Cluster: Leucine-rich repeat;
            Leucine-rich; n=1; Medicago truncatula|Rep: Leucine-rich
            repeat; Leucine-rich - Medicago truncatula (Barrel
            medic), partial (13%)
          Length = 498

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 107/133 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1466 aaatgcatgatttgatacaagaaatgggttggcaaattgttcgtgaagaatctatgaagc 1525
            |||||||||| |||||||||||||||||     | ||||||  | | |||||||| ||  
Sbjct: 22   aaatgcatgacttgatacaagaaatgggccataatattgttgatcaggaatctatcaatg 81

                                                                        
Query: 1526 agcctggaaaacgaagtcggttgtgggatcctaaagaaatttatgatgttctcaagaata 1585
            | ||||| ||||||||||| |||||||||||| | ||| | |||||||| || ||  |||
Sbjct: 82   atcctgggaaacgaagtcgattgtgggatcctcaggaagtatatgatgtgctgaaatata 141

                         
Query: 1586 acaggggaactga 1598
            | |||||||||||
Sbjct: 142  ataggggaactga 154


>gnl|LJGI|TC80360 weakly similar to UniRef100_A7QGI5 Cluster: Chromosome undetermined
           scaffold_92, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_92, whole
           genome shotgun sequence - Vitis vinifera (Grape),
           partial (47%)
          Length = 984

 Score = 58.0 bits (29), Expect = 3e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 250 tatgcttcttctaagtggtgtttggatgaactc 282
           |||||||||||||||||||||||||| ||||||
Sbjct: 263 tatgcttcttctaagtggtgtttggaggaactc 295


>gnl|LJGI|TC67617 weakly similar to UniRef100_A7PPX7 Cluster: Chromosome chr18
           scaffold_24, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_24, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (6%)
          Length = 633

 Score = 56.0 bits (28), Expect = 1e-06
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                       
Query: 614 tggaatcattgttgtgttcagggtcaactgatgtacgtattgttggaatatggggtatgg 673
           ||||||||||||| |||  || |||||  || || ||| || ||||||| ||||||||||
Sbjct: 351 tggaatcattgttatgtcaagagtcaaaagacgtgcgtgttattggaatttggggtatgg 410

                                       
Query: 674 gtggcgtaggtaagacaaccattgcaga 701
           | ||| | || |||||||||||||||||
Sbjct: 411 ggggcattggcaagacaaccattgcaga 438