Miyakogusa Predicted Gene

Lj0g3v0282399.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0282399.1 tr|A1WRX6|A1WRX6_VEREI Dihydrodipicolinate
synthetase OS=Verminephrobacter eiseniae (strain EF01-2)
,35.14,7.6,seg,NULL,CUFF.18787.1
         (373 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79389                                                       56   2e-07

>gnl|LJGI|TC79389 
          Length = 793

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 160 ttttgccctccactcccatcacaagatcaacttccagcag 199
           ||||||||| |||||||||||  |||||||||||||||||
Sbjct: 363 ttttgcccttcactcccatcatgagatcaacttccagcag 402