Miyakogusa Predicted Gene

Lj0g3v0282249.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0282249.1 Non Chatacterized Hit- tr|A5BUV6|A5BUV6_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,61.29,2,coiled-coil,NULL; Ribonuclease H-like,Ribonuclease H-like
domain; SUBFAMILY NOT NAMED,NULL; UNCHARAC,CUFF.18779.1
         (1275 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75246 similar to UniRef100_Q91T35 Cluster: Early tran...   174   9e-43

>gnl|LJGI|TC75246 similar to UniRef100_Q91T35 Cluster: Early transcription factor small
            subunit; n=1; Lumpy skin disease virus|Rep: Early
            transcription factor small subunit - Lumpy skin disease
            virus (LSDV), partial (7%)
          Length = 506

 Score =  174 bits (88), Expect = 9e-43
 Identities = 88/88 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1188 tgagaagattgttgatgatgtttcttctaagattcatgaatcgcaaagagggaatgacac 1247
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    tgagaagattgttgatgatgtttcttctaagattcatgaatcgcaaagagggaatgacac 60

                                        
Query: 1248 gcaagaggctatgcatgttgattgaact 1275
            ||||||||||||||||||||||||||||
Sbjct: 61   gcaagaggctatgcatgttgattgaact 88