Miyakogusa Predicted Gene
- Lj0g3v0281509.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0281509.1 Non Chatacterized Hit- tr|G7KSN5|G7KSN5_MEDTR
Putative uncharacterized protein (Fragment)
OS=Medicag,51.05,7e-17,seg,NULL; NB-ARC,NB-ARC; no description,NULL;
coiled-coil,NULL; LEUCINE-RICH REPEAT-CONTAINING PROTE,CUFF.18720.1
(1491 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61478 similar to UniRef100_A2Q3B4 Cluster: Disease re... 94 3e-18
>gnl|LJGI|TC61478 similar to UniRef100_A2Q3B4 Cluster: Disease resistance protein;
Calcium-binding EF-hand; n=1; Medicago truncatula|Rep:
Disease resistance protein; Calcium-binding EF-hand -
Medicago truncatula (Barrel medic), partial (40%)
Length = 840
Score = 93.7 bits (47), Expect = 3e-18
Identities = 62/67 (92%)
Strand = Plus / Plus
Query: 1228 gatattttacctgctcttaagttaagctatgatcaaatgccattctatttgaaacaatgt 1287
|||||||||||||||||||| |||||||||||| ||||||||| |||||||| ||| |||
Sbjct: 199 gatattttacctgctcttaaattaagctatgatgaaatgccatcctatttgagacactgt 258
Query: 1288 tttgctt 1294
|||||||
Sbjct: 259 tttgctt 265