Miyakogusa Predicted Gene

Lj0g3v0279749.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0279749.1 tr|C4P7K9|C4P7K9_9ROSI Ornithine aminotransferase
(Fragment) OS=Populus maximowiczii x Populus
nigra,77.97,3e-19,ORNITHINE AMINOTRANSFERASE,Ornithine
aminotransferase; AMINOTRANSFERASE CLASS III,Aminotransferase
c,NODE_49203_length_182_cov_550.598877.path1.1
         (180 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57768 similar to UniRef100_Q38IW9 Cluster: Ornithine ...   355   6e-98
gnl|LJGI|TC57746 similar to UniRef100_Q38IW9 Cluster: Ornithine ...    64   3e-10

>gnl|LJGI|TC57768 similar to UniRef100_Q38IW9 Cluster: Ornithine aminotransferase; n=1;
            Glycine max|Rep: Ornithine aminotransferase - Glycine max
            (Soybean), partial (90%)
          Length = 1603

 Score =  355 bits (179), Expect = 6e-98
 Identities = 179/179 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgctttgtataaaacctggacagcatggaagtacctttgggggaaatccattggccagt 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 847  atgctttgtataaaacctggacagcatggaagtacctttgggggaaatccattggccagt 906

                                                                        
Query: 61   gcagttgctattgcctcactagatgtgatcaaggaggagagacttgtagagagatctgcc 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907  gcagttgctattgcctcactagatgtgatcaaggaggagagacttgtagagagatctgcc 966

                                                                       
Query: 121  caaatgggagaggagcttcttaatcagctgcgtaagattcagcagaaattcccggatca 179
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 967  caaatgggagaggagcttcttaatcagctgcgtaagattcagcagaaattcccggatca 1025


>gnl|LJGI|TC57746 similar to UniRef100_Q38IW9 Cluster: Ornithine aminotransferase;
           n=1; Glycine max|Rep: Ornithine aminotransferase -
           Glycine max (Soybean), partial (67%)
          Length = 1188

 Score = 63.9 bits (32), Expect = 3e-10
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 1   atgctttgtataaaacctggacagcatggaag 32
           ||||||||||||||||||||||||||||||||
Sbjct: 968 atgctttgtataaaacctggacagcatggaag 999