Miyakogusa Predicted Gene

Lj0g3v0279729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0279729.1 NODE_38046_length_109_cov_221.605499.path2.1
         (150 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57768 similar to UniRef100_Q38IW9 Cluster: Ornithine ...   289   2e-78
gnl|LJGI|TC57746 similar to UniRef100_Q38IW9 Cluster: Ornithine ...   266   3e-71

>gnl|LJGI|TC57768 similar to UniRef100_Q38IW9 Cluster: Ornithine aminotransferase;
           n=1; Glycine max|Rep: Ornithine aminotransferase -
           Glycine max (Soybean), partial (90%)
          Length = 1603

 Score =  289 bits (146), Expect = 2e-78
 Identities = 149/150 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgattgctgatgaaatccaatctggattaggaagagcaggaaagatgctggcttgtgac 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 694 atgattgctgatgaaatccaatctggattaggaagagcagggaagatgctggcttgtgac 753

                                                                       
Query: 61  tgggaagatgtccgtcccgatgtagtgatactggcaaaagcattgggtggtggaatttta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 754 tgggaagatgtccgtcccgatgtagtgatactggcaaaagcattgggtggtggaatttta 813

                                         
Query: 121 ccagttagtgcagttcttgcagacaaagat 150
           ||||||||||||||||||||||||||||||
Sbjct: 814 ccagttagtgcagttcttgcagacaaagat 843


>gnl|LJGI|TC57746 similar to UniRef100_Q38IW9 Cluster: Ornithine aminotransferase;
           n=1; Glycine max|Rep: Ornithine aminotransferase -
           Glycine max (Soybean), partial (67%)
          Length = 1188

 Score =  266 bits (134), Expect = 3e-71
 Identities = 146/150 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgattgctgatgaaatccaatctggattaggaagagcaggaaagatgctggcttgtgac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 815 atgattgctgatgaaatccaatctggattaggaagagcaggaaagatgctggcttgtgac 874

                                                                       
Query: 61  tgggaagatgtccgtcccgatgtagtgatactggcaaaagcattgggtggtggaatttta 120
           ||||||||||| || |||||| ||||||||||||| ||||||||||||||||||||||||
Sbjct: 875 tgggaagatgttcgccccgatatagtgatactggcgaaagcattgggtggtggaatttta 934

                                         
Query: 121 ccagttagtgcagttcttgcagacaaagat 150
           ||||||||||||||||||||||||||||||
Sbjct: 935 ccagttagtgcagttcttgcagacaaagat 964