Miyakogusa Predicted Gene

Lj0g3v0279399.3

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0279399.3 Non Chatacterized Hit- tr|I1NEC5|I1NEC5_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,72.05,0,Pkinase,Protein kinase, catalytic domain; MAPK KINASE
2-RELATED,NULL; PROTEIN KINASE RELATED,NULL; P,CUFF.18589.3
         (939 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP077508                                                      98   1e-19
gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FM...    90   3e-17

>gnl|LJGI|BP077508 
          Length = 381

 Score = 97.6 bits (49), Expect = 1e-19
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 293 ccaggttccatgagtctaaaattcaagagattcttggagggcttgcttaacaa 241


>gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FMRFamide-like
           neuropeptides precursor [Contains: Neuropeptide AF10
           (GFGDEMSMPGVLRF-amide); Neuropeptide AF20
           (GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
           Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
           (SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)];
           n=1; Ascaris suum|Rep: FMRFamide-like neuropeptides
           precursor [Contains: Neuropeptide AF10
           (GFGDEMSMPGVLRF-amide); Neuropeptide AF20
           (GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
           Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
           (SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)]
           - Ascaris suum (Pig roundworm) (Ascaris lumbricoides),
           partial (16%)
          Length = 434

 Score = 89.7 bits (45), Expect = 3e-17
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
           |||||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 366 ccaggttctatgagtctaaaattcaagagattcttggagggcttgcttaacaa 314