Miyakogusa Predicted Gene

Lj0g3v0279399.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0279399.2 tr|K1QZA0|K1QZA0_CRAGI Serine/threonine-protein
kinase 36 OS=Crassostrea gigas PE=4 SV=1,28.57,4e-17,coiled-coil,NULL;
Pkinase,Protein kinase, catalytic domain; HEAT_2,NULL; MAPK KINASE
2-RELATED,NULL;,CUFF.18589.2
         (1974 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV418567 similar to UniRef100_A7PBE5 Cluster: Chromosom...   280   3e-74
gnl|LJGI|TC70050 similar to UniRef100_A7PBE5 Cluster: Chromosome...   196   4e-49
gnl|LJGI|BP077508                                                      98   3e-19
gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FM...    90   6e-17

>gnl|LJGI|AV418567 similar to UniRef100_A7PBE5 Cluster: Chromosome chr16 scaffold_10,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr16 scaffold_10, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (7%)
          Length = 268

 Score =  280 bits (141), Expect = 3e-74
 Identities = 222/249 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1292 tcacactcaatgctctcatgataatttctaatcttgctcgcatggaccagatattctatg 1351
            |||||||  ||||||| |||||||||||| || |||||||||||||| ||| |||||| |
Sbjct: 1    tcacactagatgctcttatgataatttctgattttgctcgcatggacaagagattctacg 60

                                                                        
Query: 1352 agtacattgaaggtgcttctattttggagtcttttaaagtcttactttcgcatgaggatc 1411
            |||||||  ||| |||||||||||||||||  || || | ||| ||||||||||||||||
Sbjct: 61   agtacatcaaagctgcttctattttggagttcttaaaggcctttctttcgcatgaggatc 120

                                                                        
Query: 1412 ccaatatacgtgctaaatcttgcagtgctcttggaaacatgtgtcgtcataacgactact 1471
            |||| |||||||| |||||||||||||||||||||||||||||||| || | || |||||
Sbjct: 121  ccaacatacgtgccaaatcttgcagtgctcttggaaacatgtgtcgccacagcgcctact 180

                                                                        
Query: 1472 tttatagttcacttgcaagacaccaaattattagtatccttgtcgatcggtgttatgatc 1531
            |||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||||
Sbjct: 181  tttatagttcacttgcaagacatcaaattgttagtatccttatcgatcggtgttctgatc 240

                     
Query: 1532 cggacaaac 1540
            |||||||||
Sbjct: 241  cggacaaac 249


>gnl|LJGI|TC70050 similar to UniRef100_A7PBE5 Cluster: Chromosome chr16 scaffold_10,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr16 scaffold_10, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (8%)
          Length = 669

 Score =  196 bits (99), Expect = 4e-49
 Identities = 147/163 (90%)
 Strand = Plus / Plus

                                                                        
Query: 1781 gcagaagtgattcagcaagtgaatccccttcagagatagcgctctatgccctagcaaaga 1840
            |||||| |||||||||||||||||| |||| | ||||||| |||| | ||||||||||||
Sbjct: 163  gcagaaatgattcagcaagtgaatctcctttaaagatagccctcttttccctagcaaaga 222

                                                                        
Query: 1841 tgtgtgcatatccactctgcagacagttcatacgttcatcacctatgttgcctgtgatta 1900
            |||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 223  tgtgtgcacatccactctgcagacagttcatacgttcatcacctttgtcgcctgtgatta 282

                                                       
Query: 1901 gaaggcttcagcggtctccaaaatcatccattgctaaaaatgc 1943
            | |||||||||| ||||||| ||||||| ||||| ||| ||||
Sbjct: 283  gtaggcttcagcagtctccagaatcatctattgccaaatatgc 325



 Score =  180 bits (91), Expect = 2e-44
 Identities = 127/139 (91%)
 Strand = Plus / Plus

                                                                        
Query: 1643 tgcaaatggcagaggatgacatgactaaggcaaatgcagcaggtgcacttagcaatctgg 1702
            |||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||
Sbjct: 1    tgcaaatggcagaggaggacaagactaaggcaaatgcagcaggtgcgcttagcaatctgg 60

                                                                        
Query: 1703 ttcgcaactctgacaaactttgtgaagacatggtgtcaaaaggagcgattcagtctcttc 1762
            ||||||| || || |||||||||||||| || |||||  |||| |||||||||||||| |
Sbjct: 61   ttcgcaattcggagaaactttgtgaagatattgtgtcccaaggcgcgattcagtctctcc 120

                               
Query: 1763 tgaagttaatttctgattg 1781
            |||||||||||||||||||
Sbjct: 121  tgaagttaatttctgattg 139


>gnl|LJGI|BP077508 
          Length = 381

 Score = 97.6 bits (49), Expect = 3e-19
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 293 ccaggttccatgagtctaaaattcaagagattcttggagggcttgcttaacaa 241


>gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FMRFamide-like
           neuropeptides precursor [Contains: Neuropeptide AF10
           (GFGDEMSMPGVLRF-amide); Neuropeptide AF20
           (GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
           Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
           (SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)];
           n=1; Ascaris suum|Rep: FMRFamide-like neuropeptides
           precursor [Contains: Neuropeptide AF10
           (GFGDEMSMPGVLRF-amide); Neuropeptide AF20
           (GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
           Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
           (SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)]
           - Ascaris suum (Pig roundworm) (Ascaris lumbricoides),
           partial (16%)
          Length = 434

 Score = 89.7 bits (45), Expect = 6e-17
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
           |||||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 366 ccaggttctatgagtctaaaattcaagagattcttggagggcttgcttaacaa 314