Miyakogusa Predicted Gene
- Lj0g3v0279399.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0279399.2 tr|K1QZA0|K1QZA0_CRAGI Serine/threonine-protein
kinase 36 OS=Crassostrea gigas PE=4 SV=1,28.57,4e-17,coiled-coil,NULL;
Pkinase,Protein kinase, catalytic domain; HEAT_2,NULL; MAPK KINASE
2-RELATED,NULL;,CUFF.18589.2
(1974 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV418567 similar to UniRef100_A7PBE5 Cluster: Chromosom... 280 3e-74
gnl|LJGI|TC70050 similar to UniRef100_A7PBE5 Cluster: Chromosome... 196 4e-49
gnl|LJGI|BP077508 98 3e-19
gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FM... 90 6e-17
>gnl|LJGI|AV418567 similar to UniRef100_A7PBE5 Cluster: Chromosome chr16 scaffold_10,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr16 scaffold_10, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (7%)
Length = 268
Score = 280 bits (141), Expect = 3e-74
Identities = 222/249 (89%)
Strand = Plus / Plus
Query: 1292 tcacactcaatgctctcatgataatttctaatcttgctcgcatggaccagatattctatg 1351
||||||| ||||||| |||||||||||| || |||||||||||||| ||| |||||| |
Sbjct: 1 tcacactagatgctcttatgataatttctgattttgctcgcatggacaagagattctacg 60
Query: 1352 agtacattgaaggtgcttctattttggagtcttttaaagtcttactttcgcatgaggatc 1411
||||||| ||| ||||||||||||||||| || || | ||| ||||||||||||||||
Sbjct: 61 agtacatcaaagctgcttctattttggagttcttaaaggcctttctttcgcatgaggatc 120
Query: 1412 ccaatatacgtgctaaatcttgcagtgctcttggaaacatgtgtcgtcataacgactact 1471
|||| |||||||| |||||||||||||||||||||||||||||||| || | || |||||
Sbjct: 121 ccaacatacgtgccaaatcttgcagtgctcttggaaacatgtgtcgccacagcgcctact 180
Query: 1472 tttatagttcacttgcaagacaccaaattattagtatccttgtcgatcggtgttatgatc 1531
|||||||||||||||||||||| |||||| ||||||||||| |||||||||||| |||||
Sbjct: 181 tttatagttcacttgcaagacatcaaattgttagtatccttatcgatcggtgttctgatc 240
Query: 1532 cggacaaac 1540
|||||||||
Sbjct: 241 cggacaaac 249
>gnl|LJGI|TC70050 similar to UniRef100_A7PBE5 Cluster: Chromosome chr16 scaffold_10,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr16 scaffold_10, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (8%)
Length = 669
Score = 196 bits (99), Expect = 4e-49
Identities = 147/163 (90%)
Strand = Plus / Plus
Query: 1781 gcagaagtgattcagcaagtgaatccccttcagagatagcgctctatgccctagcaaaga 1840
|||||| |||||||||||||||||| |||| | ||||||| |||| | ||||||||||||
Sbjct: 163 gcagaaatgattcagcaagtgaatctcctttaaagatagccctcttttccctagcaaaga 222
Query: 1841 tgtgtgcatatccactctgcagacagttcatacgttcatcacctatgttgcctgtgatta 1900
|||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||
Sbjct: 223 tgtgtgcacatccactctgcagacagttcatacgttcatcacctttgtcgcctgtgatta 282
Query: 1901 gaaggcttcagcggtctccaaaatcatccattgctaaaaatgc 1943
| |||||||||| ||||||| ||||||| ||||| ||| ||||
Sbjct: 283 gtaggcttcagcagtctccagaatcatctattgccaaatatgc 325
Score = 180 bits (91), Expect = 2e-44
Identities = 127/139 (91%)
Strand = Plus / Plus
Query: 1643 tgcaaatggcagaggatgacatgactaaggcaaatgcagcaggtgcacttagcaatctgg 1702
|||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||
Sbjct: 1 tgcaaatggcagaggaggacaagactaaggcaaatgcagcaggtgcgcttagcaatctgg 60
Query: 1703 ttcgcaactctgacaaactttgtgaagacatggtgtcaaaaggagcgattcagtctcttc 1762
||||||| || || |||||||||||||| || ||||| |||| |||||||||||||| |
Sbjct: 61 ttcgcaattcggagaaactttgtgaagatattgtgtcccaaggcgcgattcagtctctcc 120
Query: 1763 tgaagttaatttctgattg 1781
|||||||||||||||||||
Sbjct: 121 tgaagttaatttctgattg 139
>gnl|LJGI|BP077508
Length = 381
Score = 97.6 bits (49), Expect = 3e-19
Identities = 52/53 (98%)
Strand = Plus / Minus
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 293 ccaggttccatgagtctaaaattcaagagattcttggagggcttgcttaacaa 241
>gnl|LJGI|BP042848 weakly similar to UniRef100_P41854 Cluster: FMRFamide-like
neuropeptides precursor [Contains: Neuropeptide AF10
(GFGDEMSMPGVLRF-amide); Neuropeptide AF20
(GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
(SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)];
n=1; Ascaris suum|Rep: FMRFamide-like neuropeptides
precursor [Contains: Neuropeptide AF10
(GFGDEMSMPGVLRF-amide); Neuropeptide AF20
(GMPGVLRF-amide); Neuropeptide AF3 (AVPGVLRF-amide);
Neuropeptide AF4 (GDVPGVLRF-amide); Neuropeptide AF13
(SDMPGVLRF-amide); Neuropeptide AF14 (SMPGVLRF- amide)]
- Ascaris suum (Pig roundworm) (Ascaris lumbricoides),
partial (16%)
Length = 434
Score = 89.7 bits (45), Expect = 6e-17
Identities = 51/53 (96%)
Strand = Plus / Minus
Query: 463 ccaggttccatgagtctaaaattcaagagattcttagagggcttgcttaacaa 515
|||||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 366 ccaggttctatgagtctaaaattcaagagattcttggagggcttgcttaacaa 314