Miyakogusa Predicted Gene
- Lj0g3v0278949.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0278949.2 tr|G7J3H4|G7J3H4_MEDTR Class III HD-Zip protein
OS=Medicago truncatula GN=MTR_3g109800 PE=3
SV=1,90.85,0,Homeodomain-like,Homeodomain-like;
HOMEOBOX_2,Homeodomain; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAME,CUFF.18563.2
(432 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70081 homologue to UniRef100_A8E664 Cluster: Class II... 100 1e-20
gnl|LJGI|BP056674 similar to UniRef100_Q5D1M5 Cluster: Class III... 90 1e-17
>gnl|LJGI|TC70081 homologue to UniRef100_A8E664 Cluster: Class III HD-Zip protein
CNA2; n=1; Medicago truncatula|Rep: Class III HD-Zip
protein CNA2 - Medicago truncatula (Barrel medic),
partial (20%)
Length = 652
Score = 99.6 bits (50), Expect = 1e-20
Identities = 143/174 (82%)
Strand = Plus / Plus
Query: 73 tacacgccggagcaggtggaagcacttgaaaggctttaccatgaatgccccaaacccacc 132
|||||||| |||||||| ||||| || || |||||||| || || ||||| || ||||
Sbjct: 401 tacacgccagagcaggttgaagccctcgagaggctttatcacgagtgccctaagcccagt 460
Query: 133 tccctccgccgccaacaactcatcagagagtgccccattctctctcacatagaacctaag 192
||| | |||||||| || ||||| | |||||| | |||||||| |||| || |||| |
Sbjct: 461 tccattcgccgccagcagctcatacgcgagtgcgctattctctccaacattgagcctagg 520
Query: 193 cagatcaaggtttggttccaaaacagaaggtgcagagagaagcagaggaaagaa 246
|||||||| ||||||||||| |||||||| || |||||||||||||| ||||||
Sbjct: 521 cagatcaaagtttggttccagaacagaagatgtagagagaagcagagaaaagaa 574
>gnl|LJGI|BP056674 similar to UniRef100_Q5D1M5 Cluster: Class III HD-Zip protein 2;
n=1; Populus trichocarpa|Rep: Class III HD-Zip protein 2
- Populus trichocarpa (Western balsam poplar) (Populus
balsamiferasubsp. trichocarpa), partial (18%)
Length = 553
Score = 89.7 bits (45), Expect = 1e-17
Identities = 141/173 (81%)
Strand = Plus / Plus
Query: 184 gaacctaagcagatcaaggtttggttccaaaacagaaggtgcagagagaagcagaggaaa 243
||||| ||||||||||| |||||||| || || | ||||| |||||||||||||| |||
Sbjct: 228 gaaccgaagcagatcaaagtttggtttcagaatcgcaggtgtagagagaagcagagaaaa 287
Query: 244 gaatcatcacggctgcaagctgtgaacaggaagctaacagcgatgaataaactattgatg 303
|| | || |||| || ||||||||| ||||||| | || ||||| ||| | ||||||
Sbjct: 288 gaggcttctaggcttcaggctgtgaaccggaagctgaatgcaatgaacaaattgttgatg 347
Query: 304 gaggaaaacgacagattgcagaagcaggtgtcacagttggtgtacgagaatgg 356
||||| || || | |||||||| ||||||||||||||||||| ||||||||
Sbjct: 348 gaggagaatgatcggttgcagaaacaggtgtcacagttggtgtgtgagaatgg 400