Miyakogusa Predicted Gene

Lj0g3v0278519.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0278519.1 Non Chatacterized Hit- tr|B8BJN6|B8BJN6_ORYSI
Putative uncharacterized protein OS=Oryza sativa
subsp,73.68,0.000000000000001,seg,NULL;
UNCHARACTERIZED,NULL,CUFF.18524.1
         (627 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78695 similar to UniRef100_A2Q4U5 Cluster: Tubulin bi...   626   e-179
gnl|LJGI|TC61497 homologue to UniRef100_A2Q4U5 Cluster: Tubulin ...   147   1e-34
gnl|LJGI|TC70570 similar to UniRef100_A2Q4U5 Cluster: Tubulin bi...   139   2e-32

>gnl|LJGI|TC78695 similar to UniRef100_A2Q4U5 Cluster: Tubulin binding cofactor C;
           n=1; Medicago truncatula|Rep: Tubulin binding cofactor C
           - Medicago truncatula (Barrel medic), partial (12%)
          Length = 556

 Score =  626 bits (316), Expect = e-179
 Identities = 326/328 (99%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgacgacggacccaatcgaaccaccttccacgagcaccaccaccaccattcgcccacgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 229 atgacgacggacccaatcgaaccaccttccacgagcaccaccaccaccattcgcccacgg 288

                                                                       
Query: 61  cgcgagcccttcgagcacggtctcttacccatccccaagctcatcttctccgacccaacc 120
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 289 cgcgagcccttcgagcacggtctcttacccatcaccaagctcatcttctccgacccaacc 348

                                                                       
Query: 121 caaaccctaaccaccttca-aacacaagctcctccatgactcgtcgtccagccaccgagt 179
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 349 caaaccctaaccaccttcagaacacaagctcctccatgactcgtcgtccagccaccgagt 408

                                                                       
Query: 180 cgactcgtccgccatctccgagtcgctccagatccccctcgaccacgctaacctcctcct 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 cgactcgtccgccatctccgagtcgctccagatccccctcgaccacgctaacctcctcct 468

                                                                       
Query: 240 tgacaccctcgcttccgtccaccactccccctccgaccctctggttcgggccgagccagg 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 tgacaccctcgcttccgtccaccactccccctccgaccctctggttcgggccgagccagg 528

                                       
Query: 300 acgaaacgacgcagtcggtgctgatgtg 327
           ||||||||||||||||||||||||||||
Sbjct: 529 acgaaacgacgcagtcggtgctgatgtg 556


>gnl|LJGI|TC61497 homologue to UniRef100_A2Q4U5 Cluster: Tubulin binding cofactor C;
           n=1; Medicago truncatula|Rep: Tubulin binding cofactor C
           - Medicago truncatula (Barrel medic), partial (42%)
          Length = 918

 Score =  147 bits (74), Expect = 1e-34
 Identities = 176/210 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 tggccttccacttcggctttcgacggctacttgtccgctctctccccacttcagcttgtg 477
           |||||||| || || || ||||| || ||||||||||||||||| || ||||||||||||
Sbjct: 528 tggccttcaacctccgccttcgatggatacttgtccgctctctctccgcttcagcttgtg 587

                                                                       
Query: 478 cgcagcaacagtcggcgttttgttccatcgcaggctgatgaagaggcacaccagttatcg 537
           ||||||||||||||||| ||  | || ||||||  |||||||||||| ||||| || | |
Sbjct: 588 cgcagcaacagtcggcggttcatgccgtcgcagaatgatgaagaggcgcaccaattgttg 647

                                                                       
Query: 538 tatctgcaaaagcaccttgctaacattctatctcttctagcggagcaggtggaaggggaa 597
           ||||||||||||||| | ||||||||||| |||||||| || ||||  ||||| ||||||
Sbjct: 648 tatctgcaaaagcacttggctaacattctgtctcttctggcagagcctgtggagggggaa 707

                                         
Query: 598 gaagaagaatctctggttttaactatggat 627
              ||||| || ||||| ||||| ||||||
Sbjct: 708 cccgaagagtcactggtgttaaccatggat 737


>gnl|LJGI|TC70570 similar to UniRef100_A2Q4U5 Cluster: Tubulin binding cofactor C;
           n=1; Medicago truncatula|Rep: Tubulin binding cofactor C
           - Medicago truncatula (Barrel medic), partial (29%)
          Length = 736

 Score =  139 bits (70), Expect = 2e-32
 Identities = 136/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 418 tggccttccacttcggctttcgacggctacttgtccgctctctccccacttcagcttgtg 477
           |||||||| || || || ||||| || ||||||||||||||||| || ||||||||||||
Sbjct: 575 tggccttcaacctccgccttcgatggatacttgtccgctctctctccgcttcagcttgtg 634

                                                                       
Query: 478 cgcagcaacagtcggcgttttgttccatcgcaggctgatgaagaggcacaccagttatcg 537
           ||||||||||||||||| ||  | || ||||||  |||||||||||| ||||| || | |
Sbjct: 635 cgcagcaacagtcggcggttcatgccgtcgcagaatgatgaagaggcgcaccaattgttg 694

                                                 
Query: 538 tatctgcaaaagcaccttgctaacattctatctcttct 575
           ||||||||||||||| | ||||||||||| ||||||||
Sbjct: 695 tatctgcaaaagcacttggctaacattctgtctcttct 732