Miyakogusa Predicted Gene

Lj0g3v0278189.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0278189.1 tr|B4FS28|B4FS28_MAIZE Serine/threonine-protein
phosphatase OS=Zea mays PE=2
SV=1,81.48,2e-19,STPHPHTASE,Serine/threonine-specific protein
phosphatase/bis(5-nucleosyl)-tetraphosphatase; no descr,CUFF.18485.1
         (205 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP030746 similar to UniRef100_Q1STP0 Cluster: Serine/th...    94   4e-19

>gnl|LJGI|BP030746 similar to UniRef100_Q1STP0 Cluster: Serine/threonine protein
           phosphatase; n=1; Medicago truncatula|Rep:
           Serine/threonine protein phosphatase - Medicago
           truncatula (Barrel medic), partial (5%)
          Length = 436

 Score = 93.7 bits (47), Expect = 4e-19
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                              
Query: 152 aaactttactctgttcattccagattatcaaacccttgagaggaaaaacct 202
           ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 436 aaactttactctgttcatttcagattatcaaacccttgagaggaaaaacct 386