Miyakogusa Predicted Gene

Lj0g3v0277349.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0277349.1 Non Chatacterized Hit- tr|I1MK11|I1MK11_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.30176
PE,76.74,0.0000000002, ,CUFF.18410.1
         (150 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP067127 similar to UniRef100_Q76JT3 Cluster: RelA-SpoT...   127   2e-29

>gnl|LJGI|BP067127 similar to UniRef100_Q76JT3 Cluster: RelA-SpoT like protein PsRSH1;
           n=1; Pisum sativum|Rep: RelA-SpoT like protein PsRSH1 -
           Pisum sativum (Garden pea), partial (11%)
          Length = 346

 Score =  127 bits (64), Expect = 2e-29
 Identities = 117/134 (87%), Gaps = 3/134 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggtggtttctactgtagctttatacgcgagtccaccgagcagtgtgtgttcaacgccg 60
           |||| |||||||||| ||||| |||||||||||||||||||||||||||||||| | |||
Sbjct: 38  atggcggtttctactatagctctatacgcgagtccaccgagcagtgtgtgttcaccaccg 97

                                                                       
Query: 61  catccttgcccgccgcacacttcctacgacttcaaattggggtctagatcttcctctccg 120
           |||||||||||||   |  ||||||| |||||  |||||||  ||||||||||||| |||
Sbjct: 98  catccttgcccgc---atgcttcctatgactttgaattgggagctagatcttcctcgccg 154

                         
Query: 121 gcgtcgacagcgac 134
           || |||||||||||
Sbjct: 155 gcatcgacagcgac 168