Miyakogusa Predicted Gene
- Lj0g3v0276839.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0276839.2 Non Chatacterized Hit- tr|D8SJT1|D8SJT1_SELML
Putative uncharacterized protein (Fragment)
OS=Selagin,27.62,0.00000000002,no description,PLC-like
phosphodiesterase, TIM beta/alpha-barrel domain; GLYCEROPHOSPHORYL
DIESTER P,CUFF.18376.2
(1398 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC593364 weakly similar to UniRef100_Q7Y208 Cluster: Pr... 60 4e-08
gnl|LJGI|TC61648 similar to UniRef100_Q9FJ62 Cluster: Probable g... 60 4e-08
>gnl|LJGI|DC593364 weakly similar to UniRef100_Q7Y208 Cluster: Probable
glycerophosphoryl diester phosphodiesterase 3 precursor;
n=1; Arabidopsis thaliana|Rep: Probable
glycerophosphoryl diester phosphodiesterase 3 precursor
- Arabidopsis thaliana (Mouse-ear cress), partial (9%)
Length = 528
Score = 60.0 bits (30), Expect = 4e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 133 atagcacgtggtgggttttcagggctatttccagattc 170
|||||||||||||||||||||||| ||||||| |||||
Sbjct: 176 atagcacgtggtgggttttcagggttatttcccgattc 213
>gnl|LJGI|TC61648 similar to UniRef100_Q9FJ62 Cluster: Probable glycerophosphoryl
diester phosphodiesterase 1 precursor; n=1; Arabidopsis
thaliana|Rep: Probable glycerophosphoryl diester
phosphodiesterase 1 precursor - Arabidopsis thaliana
(Mouse-ear cress), partial (11%)
Length = 734
Score = 60.0 bits (30), Expect = 4e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 133 atagcacgtggtgggttttcagggctatttccagattc 170
|||||||||||||||||||||||| ||||||| |||||
Sbjct: 244 atagcacgtggtgggttttcagggttatttcccgattc 281