Miyakogusa Predicted Gene

Lj0g3v0276839.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0276839.1 Non Chatacterized Hit- tr|D8SJT1|D8SJT1_SELML
Putative uncharacterized protein (Fragment)
OS=Selagin,27.62,0.00000000001,no description,PLC-like
phosphodiesterase, TIM beta/alpha-barrel domain; GLYCEROPHOSPHORYL
DIESTER P,CUFF.18376.1
         (1281 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC593364 weakly similar to UniRef100_Q7Y208 Cluster: Pr...    60   4e-08
gnl|LJGI|TC61648 similar to UniRef100_Q9FJ62 Cluster: Probable g...    60   4e-08

>gnl|LJGI|DC593364 weakly similar to UniRef100_Q7Y208 Cluster: Probable
           glycerophosphoryl diester phosphodiesterase 3 precursor;
           n=1; Arabidopsis thaliana|Rep: Probable
           glycerophosphoryl diester phosphodiesterase 3 precursor
           - Arabidopsis thaliana (Mouse-ear cress), partial (9%)
          Length = 528

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 133 atagcacgtggtgggttttcagggctatttccagattc 170
           |||||||||||||||||||||||| ||||||| |||||
Sbjct: 176 atagcacgtggtgggttttcagggttatttcccgattc 213


>gnl|LJGI|TC61648 similar to UniRef100_Q9FJ62 Cluster: Probable glycerophosphoryl
           diester phosphodiesterase 1 precursor; n=1; Arabidopsis
           thaliana|Rep: Probable glycerophosphoryl diester
           phosphodiesterase 1 precursor - Arabidopsis thaliana
           (Mouse-ear cress), partial (11%)
          Length = 734

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 133 atagcacgtggtgggttttcagggctatttccagattc 170
           |||||||||||||||||||||||| ||||||| |||||
Sbjct: 244 atagcacgtggtgggttttcagggttatttcccgattc 281