Miyakogusa Predicted Gene

Lj0g3v0275429.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0275429.2 Non Chatacterized Hit- tr|I1MPC1|I1MPC1_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,74.09,0,ABC
transporter transmembrane region,ABC transporter, transmembrane
domain, type 1; ABC_TM1F,ABC tra,CUFF.18260.2
         (915 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO018799 similar to UniRef100_A7Q1J8 Cluster: Chromosom...    52   6e-06

>gnl|LJGI|GO018799 similar to UniRef100_A7Q1J8 Cluster: Chromosome chr7 scaffold_44,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_44, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 437

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 203 tttttcgtgcaccaatgtctttttatgactctacacca 240
           |||| ||||||||||||||||| | |||||||||||||
Sbjct: 197 ttttccgtgcaccaatgtctttctttgactctacacca 234