Miyakogusa Predicted Gene
- Lj0g3v0273259.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0273259.2 Non Chatacterized Hit- tr|I1N6X6|I1N6X6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.41788
PE,64.58,0,TIR,Toll/interleukin-1 receptor homology (TIR) domain; no
description,NULL; DISEASE RESISTANCE PROTE,CUFF.18073.2
(1887 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R ... 303 2e-81
gnl|LJGI|TC81080 similar to UniRef100_Q9FXZ2 Cluster: Resistance... 167 3e-40
gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 prote... 137 3e-31
gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Re... 78 2e-13
gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Fu... 74 4e-12
gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functiona... 72 1e-11
gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 prote... 70 6e-11
gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Res... 70 6e-11
gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 1... 68 2e-10
gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Res... 66 9e-10
gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Re... 64 3e-09
gnl|LJGI|TC74915 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 62 1e-08
gnl|LJGI|TC60615 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 62 1e-08
gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance... 60 5e-08
gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Fun... 60 5e-08
gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistanc... 58 2e-07
gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistanc... 58 2e-07
>gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2;
Glycine max|Rep: R 4 protein - Glycine max (Soybean),
partial (21%)
Length = 772
Score = 303 bits (153), Expect = 2e-81
Identities = 359/427 (84%), Gaps = 3/427 (0%)
Strand = Plus / Plus
Query: 141 aggggaggaaatcacgccgtcacttctcaacgcaattgaacactccaagattgccatcat 200
||||||| ||||| | || ||||||||||| ||||||||||| ||||||||||||||| |
Sbjct: 201 aggggagcaaatcgcaccatcacttctcaaggcaattgaacagtccaagattgccatcgt 260
Query: 201 tgttctctctgagaactacgcattttcgtcattctgtttagatgaactttccaagatcct 260
||||||||||||||||||||||| |||||| ||||| || || ||||||||||||||| |
Sbjct: 261 tgttctctctgagaactacgcatcttcgtcgttctgcttggaagaactttccaagatcat 320
Query: 261 tgactgcatgaaggaaatgggtcagttggtctggccagttttttatcaagtggatccttc 320
||||||||| |||||| |||||||||||||||||| ||||||||| | |||||||||||
Sbjct: 321 tgactgcattgaggaaaagggtcagttggtctggccggttttttatgatgtggatccttc 380
Query: 321 tgatgtgcggaagctgagcgggacttatggagaagccatggctatgcatgagcagaggtt 380
||||||||| ||||||| || ||||||||||||| ||||||| ||||||| |||||||
Sbjct: 381 tgatgtgcgaaagctgacaggagcttatggagaagcaatggctaagcatgaggagaggtt 440
Query: 381 caaggataacttggacaggttgatcaattggaagattgctttgtatgaagtggctaactt 440
||||||| ||||||| |||||| || |||| || ||||| | |||| ||||||||
Sbjct: 441 caaggatcacttggagaggttgcaaaaatggaggaagtctttgcagaaagtagctaactt 500
Query: 441 gtctggatggcattttaagcatggg---gtatatgaacatgatcttattaggaagattgt 497
||||||||||||||| || || ||| | ||||||| |||| ||||| | ||||| |
Sbjct: 501 gtctggatggcatttcaaacaaggggatggatatgaatatgagtttattggtaagatcct 560
Query: 498 tgaagaagtagcaagaaagatcaatccttttgctctacccattgctgattacccagttgg 557
||||||||| ||||||| ||||| | || || ||| |||||||||||||||||||
Sbjct: 561 tgaagaagtctcaagaaatatcaaatgtgttactttacatgttgctgattacccagttgg 620
Query: 558 actggag 564
| |||||
Sbjct: 621 attggag 627
>gnl|LJGI|TC81080 similar to UniRef100_Q9FXZ2 Cluster: Resistance protein LM12; n=1;
Glycine max|Rep: Resistance protein LM12 - Glycine max
(Soybean), partial (6%)
Length = 425
Score = 167 bits (84), Expect = 3e-40
Identities = 84/84 (100%)
Strand = Plus / Plus
Query: 1 atggcaccctcctccttcacctacgatgtgttcctcagcttttgtggagttgatactcga 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 atggcaccctcctccttcacctacgatgtgttcctcagcttttgtggagttgatactcga 401
Query: 61 ttcagtttcactgggaatctttac 84
||||||||||||||||||||||||
Sbjct: 402 ttcagtttcactgggaatctttac 425
>gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2; Glycine
max|Rep: R 4 protein - Glycine max (Soybean), partial
(17%)
Length = 576
Score = 137 bits (69), Expect = 3e-31
Identities = 175/209 (83%), Gaps = 1/209 (0%)
Strand = Plus / Plus
Query: 806 taaccagtgtcaaagaaggaagttcaataatacaacacaggctccgacaaaagaaggttc 865
|||| |||||||| | |||||||||||||||||||| |||||| | |||| ||| |||
Sbjct: 354 taacaagtgtcaagcagggaagttcaataatacaacataggctcaaaaaaaaaaag-ttc 412
Query: 866 ttttggttctagatgatgttgacaaaatggagcaattagaggctgttgctggaagatcta 925
|| | || |||||||||||||||| | |||||| || ||| | |||| ||||| ||
Sbjct: 413 ttctcattttagatgatgttgacaagaaggagcagttggagcatcttgccggaagccctg 472
Query: 926 attggtttggtcctggcagtagagttatcattacaacgcgggataaacacttgctagaac 985
||||||||||||||| |||||||| |||||||| || ||||||||||||||||||| |
Sbjct: 473 cttggtttggtcctggtagtagagtcatcattactactcgggataaacacttgctagcat 532
Query: 986 gtcatggggttgaaagaacatatgaagtg 1014
||||||| ||| |||||||||||||||||
Sbjct: 533 gtcatggagttaaaagaacatatgaagtg 561
Score = 71.9 bits (36), Expect = 1e-11
Identities = 170/212 (80%), Gaps = 2/212 (0%)
Strand = Plus / Plus
Query: 533 tacccattgctgattacccagttggactggagacccaagtgtcagcc-gtgatttcacct 591
|||| ||||||||||||||||||||||| ||| |||||||| | || ||| ||| | |
Sbjct: 78 tacctattgctgattacccagttggactagagtcccaagtg-cggcaagtggttttgctt 136
Query: 592 ttggatgttgagttggatgatagagtccacatggtagggatttatggaaccggtggtata 651
|||||||| || | ||||||||| |||||||||||||||||||||| || || ||
Sbjct: 137 atggatgtttggtctggtgatagagttcacatggtagggatttatggaataggagggatt 196
Query: 652 ggtaaaacaacccttgcgctatcggtttataattcggttgccatccatttcgaaagttta 711
||||||||||| ||||| ||| | ||||| || | | |||| |||||| ||| | ||
Sbjct: 197 ggtaaaacaacacttgctctagccgtttacaacttgattgctgaccattttgaaggcata 256
Query: 712 tgttttcttgaagatgttcgagaaaactcaaa 743
|||||||| ||| ||||| ||||||| |||||
Sbjct: 257 tgttttctggaaaatgttagagaaaattcaaa 288
>gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
RNEAU-2 - Glycine max (Soybean), complete
Length = 765
Score = 77.8 bits (39), Expect = 2e-13
Identities = 87/103 (84%)
Strand = Plus / Plus
Query: 844 aggctccgacaaaagaaggttcttttggttctagatgatgttgacaaaatggagcaatta 903
||||||| |||||||||||||||||||||| | ||||||||||||||| || || |||
Sbjct: 438 aggctccaacaaaagaaggttcttttggttttggatgatgttgacaaaccggcacagtta 497
Query: 904 gaggctgttgctggaagatctaattggtttggtcctggcagta 946
|||| |||| ||||||| | |||||||||| |||||||||
Sbjct: 498 aaggcacttgcaggaagatttgattggtttggctctggcagta 540
>gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max (Soybean),
partial (13%)
Length = 672
Score = 73.8 bits (37), Expect = 4e-12
Identities = 55/61 (90%)
Strand = Plus / Minus
Query: 1434 tgtgacattacatgacttgatagaggatatgggtaaagaaattgttcgacgaggatcacc 1493
||||||| |||| |||||||| ||||||||||||||||||||||| |||| || ||||||
Sbjct: 592 tgtgacactacacgacttgattgaggatatgggtaaagaaattgtgcgacaagaatcacc 533
Query: 1494 a 1494
|
Sbjct: 532 a 532
>gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functional candidate resistance
protein KR1; n=1; Glycine max|Rep: Functional candidate
resistance protein KR1 - Glycine max (Soybean), partial
(4%)
Length = 680
Score = 71.9 bits (36), Expect = 1e-11
Identities = 42/44 (95%)
Strand = Plus / Minus
Query: 1438 acattacatgacttgatagaggatatgggtaaagaaattgttcg 1481
||||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 651 acattacatgacttggtagaagatatgggtaaagaaattgttcg 608
>gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
max|Rep: R 3 protein - Glycine max (Soybean), partial
(15%)
Length = 788
Score = 69.9 bits (35), Expect = 6e-11
Identities = 56/63 (88%)
Strand = Plus / Plus
Query: 103 ggaatcaacgccttcatagatgacaagaagctcgagagaggggaggaaatcacgccgtca 162
||||||||| ||||||| ||||||||| |||| ||||||||||| |||||||| ||| ||
Sbjct: 384 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 443
Query: 163 ctt 165
|||
Sbjct: 444 ctt 446
>gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
max (Soybean), partial (26%)
Length = 790
Score = 69.9 bits (35), Expect = 6e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 1438 acattacatgacttgatagaggatatgggtaaagaaattgttcgacgaggatcaccaaa 1496
||||||||||||||||| || || |||||||||||||||||||||| || |||| ||||
Sbjct: 27 acattacatgacttgattgaagacatgggtaaagaaattgttcgactagaatcaacaaa 85
Score = 58.0 bits (29), Expect = 2e-07
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
|||||| |||||||| || ||||||||||||||||| || ||||||||||||
Sbjct: 278 tttttctaaagctccagaatatcttccaaatagtttgagggtattggaatggg 330
>gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 14 protein; n=1;
Glycine max|Rep: R 14 protein - Glycine max (Soybean),
partial (31%)
Length = 836
Score = 67.9 bits (34), Expect = 2e-10
Identities = 88/106 (83%)
Strand = Plus / Plus
Query: 229 tcattctgtttagatgaactttccaagatccttgactgcatgaaggaaatgggtcagttg 288
||||| || |||||||||||||||||||| ||||||||| ||||| ||||| |
Sbjct: 432 tcattttgcttagatgaactttccaagattcttgactgctctcaggaagagggtcgtctt 491
Query: 289 gtctggccagttttttatcaagtggatccttctgatgtgcggaagc 334
|| ||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 492 gtttggccagttttttatggtgtggatccttctgatgtgcgaaagc 537
>gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
max (Soybean), partial (18%)
Length = 823
Score = 65.9 bits (33), Expect = 9e-10
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
|||||| ||||||||||| ||||||||||||||||| || ||||||||||||
Sbjct: 195 tttttctaaagctcccgaatatcttccaaatagtttgagggtattggaatggg 247
>gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Resistance protein
nbs-lrr; n=1; Vigna unguiculata|Rep: Resistance protein
nbs-lrr - Vigna unguiculata (Cowpea), partial (46%)
Length = 524
Score = 63.9 bits (32), Expect = 3e-09
Identities = 47/52 (90%)
Strand = Plus / Plus
Query: 834 aatacaacacaggctccgacaaaagaaggttcttttggttctagatgatgtt 885
|||| ||||||||||||| |||||||| ||||||||| |||| |||||||||
Sbjct: 155 aataaaacacaggctccggcaaaagaaagttcttttgattcttgatgatgtt 206
>gnl|LJGI|TC74915 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max
(Soybean), partial (6%)
Length = 1684
Score = 61.9 bits (31), Expect = 1e-08
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 272 aggaaatgggtcagttggtctggccagttttttatcaagtggatccttctgatgtgcgg 330
|||||| ||||| |||| | ||||| ||||| ||||||||||| |||||||||||||||
Sbjct: 352 aggaaaagggtctgttgatatggcctgttttctatcaagtggaaccttctgatgtgcgg 410
>gnl|LJGI|TC60615 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max
(Soybean), partial (6%)
Length = 1171
Score = 61.9 bits (31), Expect = 1e-08
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 272 aggaaatgggtcagttggtctggccagttttttatcaagtggatccttctgatgtgcgg 330
|||||| ||||| |||| | ||||| ||||| ||||||||||| |||||||||||||||
Sbjct: 352 aggaaaagggtctgttgatatggcctgttttctatcaagtggaaccttctgatgtgcgg 410
>gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
Glycine max|Rep: Resistance protein LM17 - Glycine max
(Soybean), partial (16%)
Length = 1367
Score = 60.0 bits (30), Expect = 5e-08
Identities = 78/94 (82%)
Strand = Plus / Plus
Query: 295 ccagttttttatcaagtggatccttctgatgtgcggaagctgagcgggacttatggagaa 354
||||||||||||||||||||||| |||||||| | |||||| || ||||| || |||
Sbjct: 636 ccagttttttatcaagtggatcccgatgatgtgcaaatgctgagaggaacttacggggaa 695
Query: 355 gccatggctatgcatgagcagaggttcaaggata 388
|| || |||||||| || |||||||||| ||||
Sbjct: 696 gcaattgctatgcacaagaagaggttcaatgata 729
>gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
resistance protein KR1; n=1; Glycine max|Rep: Functional
candidate resistance protein KR1 - Glycine max (Soybean),
partial (18%)
Length = 1606
Score = 60.0 bits (30), Expect = 5e-08
Identities = 90/110 (81%)
Strand = Plus / Plus
Query: 1633 tgggatggaaaggctttcatgaagatggaaaatctcaaaacacttatcataaaagatatt 1692
||||||||||||| |||| ||| |||||||||||||| |||||||| || ||| || ||
Sbjct: 871 tgggatggaaagggcttcaagaacatggaaaatctcaagacacttattattaaaaatgtt 930
Query: 1693 tctttttccaaagctcccgagtatcttccaaatagtttaagattattgga 1742
|||||| |||||||| | ||||| || | |||||| ||| |||||||
Sbjct: 931 catttttctgaagctcccaaatatctcccgagtagtttgagagtattgga 980
Score = 54.0 bits (27), Expect = 3e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 1289 tttttcttgacattgcttgtttcttcaaagg 1319
||||||||||||||||||||| |||||||||
Sbjct: 533 tttttcttgacattgcttgttgcttcaaagg 563
>gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
RNEAU-2 - Glycine max (Soybean), partial (71%)
Length = 395
Score = 58.0 bits (29), Expect = 2e-07
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 854 aaaagaaggttcttttggttctagatgatgttgacaa 890
||||||||||||||||| |||| ||||||||||||||
Sbjct: 245 aaaagaaggttcttttgattcttgatgatgttgacaa 281
>gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
Glycine max|Rep: Resistance protein LM17 - Glycine max
(Soybean), partial (10%)
Length = 701
Score = 58.0 bits (29), Expect = 2e-07
Identities = 47/53 (88%)
Strand = Plus / Minus
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
|||||| |||||||| || ||||||||||||||||| || ||||||||||||
Sbjct: 637 tttttctaaagctccagaatatcttccaaatagtttgagggtattggaatggg 585