Miyakogusa Predicted Gene

Lj0g3v0273259.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0273259.2 Non Chatacterized Hit- tr|I1N6X6|I1N6X6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.41788
PE,64.58,0,TIR,Toll/interleukin-1 receptor homology (TIR) domain; no
description,NULL; DISEASE RESISTANCE PROTE,CUFF.18073.2
         (1887 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R ...   303   2e-81
gnl|LJGI|TC81080 similar to UniRef100_Q9FXZ2 Cluster: Resistance...   167   3e-40
gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 prote...   137   3e-31
gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Re...    78   2e-13
gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Fu...    74   4e-12
gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functiona...    72   1e-11
gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 prote...    70   6e-11
gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Res...    70   6e-11
gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 1...    68   2e-10
gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Res...    66   9e-10
gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Re...    64   3e-09
gnl|LJGI|TC74915 weakly similar to UniRef100_Q8W2C0 Cluster: Fun...    62   1e-08
gnl|LJGI|TC60615 weakly similar to UniRef100_Q8W2C0 Cluster: Fun...    62   1e-08
gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance...    60   5e-08
gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Fun...    60   5e-08
gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistanc...    58   2e-07
gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistanc...    58   2e-07

>gnl|LJGI|GO036231 weakly similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2;
           Glycine max|Rep: R 4 protein - Glycine max (Soybean),
           partial (21%)
          Length = 772

 Score =  303 bits (153), Expect = 2e-81
 Identities = 359/427 (84%), Gaps = 3/427 (0%)
 Strand = Plus / Plus

                                                                       
Query: 141 aggggaggaaatcacgccgtcacttctcaacgcaattgaacactccaagattgccatcat 200
           ||||||| ||||| | || ||||||||||| ||||||||||| ||||||||||||||| |
Sbjct: 201 aggggagcaaatcgcaccatcacttctcaaggcaattgaacagtccaagattgccatcgt 260

                                                                       
Query: 201 tgttctctctgagaactacgcattttcgtcattctgtttagatgaactttccaagatcct 260
           ||||||||||||||||||||||| |||||| ||||| || || ||||||||||||||| |
Sbjct: 261 tgttctctctgagaactacgcatcttcgtcgttctgcttggaagaactttccaagatcat 320

                                                                       
Query: 261 tgactgcatgaaggaaatgggtcagttggtctggccagttttttatcaagtggatccttc 320
           |||||||||  |||||| |||||||||||||||||| ||||||||| | |||||||||||
Sbjct: 321 tgactgcattgaggaaaagggtcagttggtctggccggttttttatgatgtggatccttc 380

                                                                       
Query: 321 tgatgtgcggaagctgagcgggacttatggagaagccatggctatgcatgagcagaggtt 380
           ||||||||| |||||||  ||  ||||||||||||| ||||||| ||||||| |||||||
Sbjct: 381 tgatgtgcgaaagctgacaggagcttatggagaagcaatggctaagcatgaggagaggtt 440

                                                                       
Query: 381 caaggataacttggacaggttgatcaattggaagattgctttgtatgaagtggctaactt 440
           ||||||| ||||||| ||||||   || |||| ||   ||||| |  |||| ||||||||
Sbjct: 441 caaggatcacttggagaggttgcaaaaatggaggaagtctttgcagaaagtagctaactt 500

                                                                       
Query: 441 gtctggatggcattttaagcatggg---gtatatgaacatgatcttattaggaagattgt 497
           ||||||||||||||| || || |||   | ||||||| ||||  ||||| | |||||  |
Sbjct: 501 gtctggatggcatttcaaacaaggggatggatatgaatatgagtttattggtaagatcct 560

                                                                       
Query: 498 tgaagaagtagcaagaaagatcaatccttttgctctacccattgctgattacccagttgg 557
           |||||||||  ||||||| |||||   | || || |||   |||||||||||||||||||
Sbjct: 561 tgaagaagtctcaagaaatatcaaatgtgttactttacatgttgctgattacccagttgg 620

                  
Query: 558 actggag 564
           | |||||
Sbjct: 621 attggag 627


>gnl|LJGI|TC81080 similar to UniRef100_Q9FXZ2 Cluster: Resistance protein LM12; n=1;
           Glycine max|Rep: Resistance protein LM12 - Glycine max
           (Soybean), partial (6%)
          Length = 425

 Score =  167 bits (84), Expect = 3e-40
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcaccctcctccttcacctacgatgtgttcctcagcttttgtggagttgatactcga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 atggcaccctcctccttcacctacgatgtgttcctcagcttttgtggagttgatactcga 401

                                   
Query: 61  ttcagtttcactgggaatctttac 84
           ||||||||||||||||||||||||
Sbjct: 402 ttcagtttcactgggaatctttac 425


>gnl|LJGI|DC593180 similar to UniRef100_Q84ZV3 Cluster: R 4 protein; n=2; Glycine
            max|Rep: R 4 protein - Glycine max (Soybean), partial
            (17%)
          Length = 576

 Score =  137 bits (69), Expect = 3e-31
 Identities = 175/209 (83%), Gaps = 1/209 (0%)
 Strand = Plus / Plus

                                                                        
Query: 806  taaccagtgtcaaagaaggaagttcaataatacaacacaggctccgacaaaagaaggttc 865
            |||| ||||||||  | |||||||||||||||||||| ||||||  | |||| ||| |||
Sbjct: 354  taacaagtgtcaagcagggaagttcaataatacaacataggctcaaaaaaaaaaag-ttc 412

                                                                        
Query: 866  ttttggttctagatgatgttgacaaaatggagcaattagaggctgttgctggaagatcta 925
            || |  || |||||||||||||||| | |||||| || |||  | |||| |||||  || 
Sbjct: 413  ttctcattttagatgatgttgacaagaaggagcagttggagcatcttgccggaagccctg 472

                                                                        
Query: 926  attggtttggtcctggcagtagagttatcattacaacgcgggataaacacttgctagaac 985
             ||||||||||||||| |||||||| |||||||| || ||||||||||||||||||| | 
Sbjct: 473  cttggtttggtcctggtagtagagtcatcattactactcgggataaacacttgctagcat 532

                                         
Query: 986  gtcatggggttgaaagaacatatgaagtg 1014
            ||||||| ||| |||||||||||||||||
Sbjct: 533  gtcatggagttaaaagaacatatgaagtg 561



 Score = 71.9 bits (36), Expect = 1e-11
 Identities = 170/212 (80%), Gaps = 2/212 (0%)
 Strand = Plus / Plus

                                                                       
Query: 533 tacccattgctgattacccagttggactggagacccaagtgtcagcc-gtgatttcacct 591
           |||| ||||||||||||||||||||||| ||| |||||||| | ||  ||| |||  | |
Sbjct: 78  tacctattgctgattacccagttggactagagtcccaagtg-cggcaagtggttttgctt 136

                                                                       
Query: 592 ttggatgttgagttggatgatagagtccacatggtagggatttatggaaccggtggtata 651
            ||||||||  ||  | ||||||||| ||||||||||||||||||||||  || || || 
Sbjct: 137 atggatgtttggtctggtgatagagttcacatggtagggatttatggaataggagggatt 196

                                                                       
Query: 652 ggtaaaacaacccttgcgctatcggtttataattcggttgccatccatttcgaaagttta 711
           ||||||||||| ||||| ||| | ||||| || | | ||||   |||||| ||| |  ||
Sbjct: 197 ggtaaaacaacacttgctctagccgtttacaacttgattgctgaccattttgaaggcata 256

                                           
Query: 712 tgttttcttgaagatgttcgagaaaactcaaa 743
           |||||||| ||| ||||| ||||||| |||||
Sbjct: 257 tgttttctggaaaatgttagagaaaattcaaa 288


>gnl|LJGI|FS339666 weakly similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
           RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
           RNEAU-2 - Glycine max (Soybean), complete
          Length = 765

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 844 aggctccgacaaaagaaggttcttttggttctagatgatgttgacaaaatggagcaatta 903
           ||||||| |||||||||||||||||||||| | |||||||||||||||  ||  || |||
Sbjct: 438 aggctccaacaaaagaaggttcttttggttttggatgatgttgacaaaccggcacagtta 497

                                                      
Query: 904 gaggctgttgctggaagatctaattggtttggtcctggcagta 946
            ||||  |||| ||||||| | ||||||||||  |||||||||
Sbjct: 498 aaggcacttgcaggaagatttgattggtttggctctggcagta 540


>gnl|LJGI|FS355588 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
            resistance protein KR1; n=1; Glycine max|Rep: Functional
            candidate resistance protein KR1 - Glycine max (Soybean),
            partial (13%)
          Length = 672

 Score = 73.8 bits (37), Expect = 4e-12
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1434 tgtgacattacatgacttgatagaggatatgggtaaagaaattgttcgacgaggatcacc 1493
            ||||||| |||| |||||||| ||||||||||||||||||||||| |||| || ||||||
Sbjct: 592  tgtgacactacacgacttgattgaggatatgggtaaagaaattgtgcgacaagaatcacc 533

             
Query: 1494 a 1494
            |
Sbjct: 532  a 532


>gnl|LJGI|FS345340 similar to UniRef100_Q8W2C0 Cluster: Functional candidate resistance
            protein KR1; n=1; Glycine max|Rep: Functional candidate
            resistance protein KR1 - Glycine max (Soybean), partial
            (4%)
          Length = 680

 Score = 71.9 bits (36), Expect = 1e-11
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                        
Query: 1438 acattacatgacttgatagaggatatgggtaaagaaattgttcg 1481
            ||||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 651  acattacatgacttggtagaagatatgggtaaagaaattgttcg 608


>gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
           max|Rep: R 3 protein - Glycine max (Soybean), partial
           (15%)
          Length = 788

 Score = 69.9 bits (35), Expect = 6e-11
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 103 ggaatcaacgccttcatagatgacaagaagctcgagagaggggaggaaatcacgccgtca 162
           ||||||||| ||||||| ||||||||| |||| ||||||||||| |||||||| ||| ||
Sbjct: 384 ggaatcaacaccttcattgatgacaaggagcttgagagaggggatgaaatcacaccggca 443

              
Query: 163 ctt 165
           |||
Sbjct: 444 ctt 446


>gnl|LJGI|TC58403 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
            n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
            max (Soybean), partial (26%)
          Length = 790

 Score = 69.9 bits (35), Expect = 6e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1438 acattacatgacttgatagaggatatgggtaaagaaattgttcgacgaggatcaccaaa 1496
            ||||||||||||||||| || || |||||||||||||||||||||| || |||| ||||
Sbjct: 27   acattacatgacttgattgaagacatgggtaaagaaattgttcgactagaatcaacaaa 85



 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
            |||||| |||||||| || ||||||||||||||||| ||  ||||||||||||
Sbjct: 278  tttttctaaagctccagaatatcttccaaatagtttgagggtattggaatggg 330


>gnl|LJGI|TC60415 weakly similar to UniRef100_Q84ZV0 Cluster: R 14 protein; n=1;
           Glycine max|Rep: R 14 protein - Glycine max (Soybean),
           partial (31%)
          Length = 836

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 229 tcattctgtttagatgaactttccaagatccttgactgcatgaaggaaatgggtcagttg 288
           ||||| || |||||||||||||||||||| |||||||||    |||||  |||||   | 
Sbjct: 432 tcattttgcttagatgaactttccaagattcttgactgctctcaggaagagggtcgtctt 491

                                                         
Query: 289 gtctggccagttttttatcaagtggatccttctgatgtgcggaagc 334
           || |||||||||||||||   |||||||||||||||||||| ||||
Sbjct: 492 gtttggccagttttttatggtgtggatccttctgatgtgcgaaagc 537


>gnl|LJGI|TC65260 weakly similar to UniRef100_Q9FVK3 Cluster: Resistance protein MG63;
            n=1; Glycine max|Rep: Resistance protein MG63 - Glycine
            max (Soybean), partial (18%)
          Length = 823

 Score = 65.9 bits (33), Expect = 9e-10
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
            |||||| ||||||||||| ||||||||||||||||| ||  ||||||||||||
Sbjct: 195  tttttctaaagctcccgaatatcttccaaatagtttgagggtattggaatggg 247


>gnl|LJGI|DC595211 weakly similar to UniRef100_Q8RYA9 Cluster: Resistance protein
           nbs-lrr; n=1; Vigna unguiculata|Rep: Resistance protein
           nbs-lrr - Vigna unguiculata (Cowpea), partial (46%)
          Length = 524

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 834 aatacaacacaggctccgacaaaagaaggttcttttggttctagatgatgtt 885
           |||| ||||||||||||| |||||||| ||||||||| |||| |||||||||
Sbjct: 155 aataaaacacaggctccggcaaaagaaagttcttttgattcttgatgatgtt 206


>gnl|LJGI|TC74915 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
           resistance protein KR1; n=1; Glycine max|Rep: Functional
           candidate resistance protein KR1 - Glycine max
           (Soybean), partial (6%)
          Length = 1684

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 272 aggaaatgggtcagttggtctggccagttttttatcaagtggatccttctgatgtgcgg 330
           |||||| ||||| |||| | ||||| ||||| ||||||||||| |||||||||||||||
Sbjct: 352 aggaaaagggtctgttgatatggcctgttttctatcaagtggaaccttctgatgtgcgg 410


>gnl|LJGI|TC60615 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
           resistance protein KR1; n=1; Glycine max|Rep: Functional
           candidate resistance protein KR1 - Glycine max
           (Soybean), partial (6%)
          Length = 1171

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 272 aggaaatgggtcagttggtctggccagttttttatcaagtggatccttctgatgtgcgg 330
           |||||| ||||| |||| | ||||| ||||| ||||||||||| |||||||||||||||
Sbjct: 352 aggaaaagggtctgttgatatggcctgttttctatcaagtggaaccttctgatgtgcgg 410


>gnl|LJGI|TC82142 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
           Glycine max|Rep: Resistance protein LM17 - Glycine max
           (Soybean), partial (16%)
          Length = 1367

 Score = 60.0 bits (30), Expect = 5e-08
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 295 ccagttttttatcaagtggatccttctgatgtgcggaagctgagcgggacttatggagaa 354
           |||||||||||||||||||||||   ||||||||  | |||||| || ||||| || |||
Sbjct: 636 ccagttttttatcaagtggatcccgatgatgtgcaaatgctgagaggaacttacggggaa 695

                                             
Query: 355 gccatggctatgcatgagcagaggttcaaggata 388
           || || ||||||||  || |||||||||| ||||
Sbjct: 696 gcaattgctatgcacaagaagaggttcaatgata 729


>gnl|LJGI|TC76008 weakly similar to UniRef100_Q8W2C0 Cluster: Functional candidate
            resistance protein KR1; n=1; Glycine max|Rep: Functional
            candidate resistance protein KR1 - Glycine max (Soybean),
            partial (18%)
          Length = 1606

 Score = 60.0 bits (30), Expect = 5e-08
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1633 tgggatggaaaggctttcatgaagatggaaaatctcaaaacacttatcataaaagatatt 1692
            |||||||||||||  |||| ||| |||||||||||||| |||||||| || ||| || ||
Sbjct: 871  tgggatggaaagggcttcaagaacatggaaaatctcaagacacttattattaaaaatgtt 930

                                                              
Query: 1693 tctttttccaaagctcccgagtatcttccaaatagtttaagattattgga 1742
              ||||||  |||||||| | ||||| || | |||||| ||| |||||||
Sbjct: 931  catttttctgaagctcccaaatatctcccgagtagtttgagagtattgga 980



 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 1289 tttttcttgacattgcttgtttcttcaaagg 1319
            ||||||||||||||||||||| |||||||||
Sbjct: 533  tttttcttgacattgcttgttgcttcaaagg 563


>gnl|LJGI|DC599951 similar to UniRef100_Q6Y4S2 Cluster: Resistance-like protein
           RNEAU-2; n=1; Glycine max|Rep: Resistance-like protein
           RNEAU-2 - Glycine max (Soybean), partial (71%)
          Length = 395

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 854 aaaagaaggttcttttggttctagatgatgttgacaa 890
           ||||||||||||||||| |||| ||||||||||||||
Sbjct: 245 aaaagaaggttcttttgattcttgatgatgttgacaa 281


>gnl|LJGI|FS357660 similar to UniRef100_Q9FVK4 Cluster: Resistance protein LM17; n=1;
            Glycine max|Rep: Resistance protein LM17 - Glycine max
            (Soybean), partial (10%)
          Length = 701

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 1695 tttttccaaagctcccgagtatcttccaaatagtttaagattattggaatggg 1747
            |||||| |||||||| || ||||||||||||||||| ||  ||||||||||||
Sbjct: 637  tttttctaaagctccagaatatcttccaaatagtttgagggtattggaatggg 585