Miyakogusa Predicted Gene

Lj0g3v0273249.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0273249.1 Non Chatacterized Hit- tr|I1MMQ7|I1MMQ7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.9693
PE=,90.48,1e-16,ACTIN-RELATED PROTEIN,NULL;
ACTIN,Actin-like,gene.Ljchr0_pseudomol_20120828.path1.gene28025.1
         (186 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71994 similar to UniRef100_Q9FKT0 Cluster: Actin-rela...    62   1e-09

>gnl|LJGI|TC71994 similar to UniRef100_Q9FKT0 Cluster: Actin-related protein 8; n=1;
           Arabidopsis thaliana|Rep: Actin-related protein 8 -
           Arabidopsis thaliana (Mouse-ear cress), partial (37%)
          Length = 772

 Score = 61.9 bits (31), Expect = 1e-09
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                       
Query: 5   gtttgcaccaggctatagctctctgcatggaccattgctattctgcagaattagcaggca 64
           ||||||||||||| |||||||| || ||||||| |||| || ||||| | ||| | |   
Sbjct: 221 gtttgcaccaggccatagctctttgtatggaccgttgccatgctgcaaacttacccgctg 280

                                                                       
Query: 65  acaatgattggtttaagaccatagtcttatcgggagggactgcatgtttaccaggcttag 124
           ||| ||||||||  |||||  |||| ||||| || ||||| ||||||||||||||||| |
Sbjct: 281 acagtgattggtacaagactgtagttttatcaggggggacagcatgtttaccaggcttgg 340

              
Query: 125 cag 127
           |||
Sbjct: 341 cag 343