Miyakogusa Predicted Gene

Lj0g3v0272159.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0272159.1 tr|I0Z5L3|I0Z5L3_9CHLO NAF1-domain-containing
protein OS=Coccomyxa subellipsoidea C-169 PE=4
SV=1,37.25,1e-17,seg,NULL; Translation proteins,Translation
elongation/initiation factor/Ribosomal, beta-barrel;
Gar1,gene.g21137.t1.1
         (582 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57781 weakly similar to UniRef100_Q6UBM1 Cluster: Vit...   147   9e-35

>gnl|LJGI|TC57781 weakly similar to UniRef100_Q6UBM1 Cluster: Vitellogenin-C; n=1;
           Aedes aegypti|Rep: Vitellogenin-C - Aedes aegypti
           (Yellowfever mosquito), partial (3%)
          Length = 797

 Score =  147 bits (74), Expect = 9e-35
 Identities = 108/118 (91%), Gaps = 1/118 (0%)
 Strand = Plus / Plus

                                                                       
Query: 60  cttaggaccacaccatcaaatgctgccagtgggagttgtcatgtcgattcttggtgctca 119
           ||||| ||||||||||||||| ||||||||||| ||||| ||||||| ||||||||||||
Sbjct: 678 cttagaaccacaccatcaaattctgccagtggg-gttgtaatgtcgactcttggtgctca 736

                                                                     
Query: 120 agtcattgtggaaggggtggagaagcatgaccctcttaatgagggctccattctctgg 177
           ||||||||||||||| ||||| ||||||||||| ||||||||||| || |||||||||
Sbjct: 737 agtcattgtggaaggagtggaaaagcatgacccacttaatgagggttctattctctgg 794