Miyakogusa Predicted Gene

Lj0g3v0270729.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0270729.1 Non Chatacterized Hit- tr|E0VDJ1|E0VDJ1_PEDHC
Putative uncharacterized protein OS=Pediculus humanus ,40.54,3.7,
,gene.Ljchr0_pseudomol_20120828.path1.gene27735.1
         (285 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS327122 similar to UniRef100_Q0WSA8 Cluster: Peptidylp...    54   5e-07
gnl|LJGI|TC62393 similar to UniRef100_Q43207 Cluster: 70 kDa pep...    54   5e-07

>gnl|LJGI|FS327122 similar to UniRef100_Q0WSA8 Cluster: Peptidylprolyl isomerase; n=1;
           Arabidopsis thaliana|Rep: Peptidylprolyl isomerase -
           Arabidopsis thaliana (Mouse-ear cress), partial (8%)
          Length = 628

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 154 ctgaagttggtgatgaagtttaagttcattagactgggatcttgcgtgatgtcaccaaat 213
           |||||| ||||||||||||  | |||||||| ||||| |  |||| ||||| ||||||||
Sbjct: 304 ctgaagctggtgatgaagtcaatgttcattatactggaacattgcttgatggcaccaaat 363

                  
Query: 214 ttgattc 220
           |||||||
Sbjct: 364 ttgattc 370


>gnl|LJGI|TC62393 similar to UniRef100_Q43207 Cluster: 70 kDa peptidyl-prolyl
           isomerase; n=1; Triticum aestivum|Rep: 70 kDa
           peptidyl-prolyl isomerase - Triticum aestivum (Wheat),
           partial (13%)
          Length = 807

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 154 ctgaagttggtgatgaagtttaagttcattagactgggatcttgcgtgatgtcaccaaat 213
           |||||| ||||||||||||  | |||||||| ||||| |  |||| ||||| ||||||||
Sbjct: 240 ctgaagctggtgatgaagtcaatgttcattatactggaacattgcttgatggcaccaaat 299

                  
Query: 214 ttgattc 220
           |||||||
Sbjct: 300 ttgattc 306