Miyakogusa Predicted Gene

Lj0g3v0270689.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0270689.1 Non Chatacterized Hit- tr|I1MHB3|I1MHB3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.7449
PE=,32.95,5e-18,seg,NULL,CUFF.17885.1
         (1585 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70351 weakly similar to UniRef100_A7QPF7 Cluster: Chr...   256   4e-67

>gnl|LJGI|TC70351 weakly similar to UniRef100_A7QPF7 Cluster: Chromosome chr18
            scaffold_137, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr18 scaffold_137, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (10%)
          Length = 585

 Score =  256 bits (129), Expect = 4e-67
 Identities = 226/257 (87%), Gaps = 6/257 (2%)
 Strand = Plus / Plus

                                                                        
Query: 1310 atgatgaggagaaaaggttcaaggtaatgagcttgcatgttggaggtttcaaggtgagga 1369
            |||| ||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||
Sbjct: 53   atgaggaggagaaaaggttcaaagtaatgagcatgcatgtgggaggtttcaaggtgagga 112

                                                                        
Query: 1370 gtggcactacaaagaagaatattgcatgggagacagagaagcaaaggctaactgcaatgc 1429
            ||| |||   ||||||||||   |||||||| |  |||||||| || ||||||||||| |
Sbjct: 113  gtgccac---aaagaagaat---gcatgggacagtgagaagcatagactaactgcaatac 166

                                                                        
Query: 1430 aatggttgattgaacatgggttgggaaaggcagggaagagaggtaaacatgcattggtaa 1489
            |||||||| ||| |||||||||||||||||||||||||| ||| ||||| ||||||| ||
Sbjct: 167  aatggttggttgcacatgggttgggaaaggcagggaagaaagggaaacaagcattggcaa 226

                                                                        
Query: 1490 aagggcaagatttgttgtggagcatttcctcaagaatcatggctgacatgtggctcaaaa 1549
            ||||||||||  |||| ||||||||||||||| | ||  | |||||||||||||||||||
Sbjct: 227  aagggcaagacctgttatggagcatttcctcacggattgttgctgacatgtggctcaaaa 286

                             
Query: 1550 ccatgagaaatccagat 1566
            |||||||||||||||||
Sbjct: 287  ccatgagaaatccagat 303