Miyakogusa Predicted Gene

Lj0g3v0269759.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0269759.1 tr|G7KJQ5|G7KJQ5_MEDTR Disease resistance-like
protein GS4-7 OS=Medicago truncatula GN=MTR_6g075690
,43.21,2e-18,RNI-like,NULL; L domain-like,NULL; no description,NULL;
seg,NULL; LRR,Leucine-rich repeat; LEUCINE-R,CUFF.17822.1
         (1344 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71288 weakly similar to UniRef100_Q84ZU8 Cluster: R 1...    78   2e-13

>gnl|LJGI|TC71288 weakly similar to UniRef100_Q84ZU8 Cluster: R 10 protein; n=1;
           Glycine max|Rep: R 10 protein - Glycine max (Soybean),
           partial (7%)
          Length = 1327

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 261 ctgcaacctttcagatgaatatttggcaataggtcttacatggtttgctaacgtgaaaga 320
           |||| |||| ||| |||||| |||||||  || |||| | | |||||||||| |||||||
Sbjct: 427 ctgccacctgtcatatgaatttttggcatcagttcttccgttgtttgctaacttgaaaga 486

                                                                       
Query: 321 attagacctatctgggagtagattcacaattgttcctgagtgcatcaaagaatgccgctt 380
           | ||||||||     ||||   ||||||||||||||| | |||||| || |||||||| |
Sbjct: 487 actagacctaagacagagtgagttcacaattgttcctaaatgcatcgaacaatgccgcat 546

                                                                       
Query: 381 tttatggaagcttgtcttgaatggttgcgagcgacttcgagagattagagagattccacc 440
           |||| |||  ||| ||||||||| |||| |||  ||||| || |||  || |||||||||
Sbjct: 547 tttaaggactcttctcttgaatgattgcaagcagcttcgggaaattgaagggattccacc 606

                      
Query: 441 aagcttaaaaa 451
           |||||||||||
Sbjct: 607 aagcttaaaaa 617