Miyakogusa Predicted Gene
- Lj0g3v0268969.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0268969.1 tr|G7JZQ3|G7JZQ3_MEDTR Cytochrome P450
OS=Medicago truncatula GN=MTR_5g073320 PE=3
SV=1,65.77,0,p450,Cytochrome P450; CYTOCHROME_P450,Cytochrome P450,
conserved site; EP450I,Cytochrome P450, E-cla,gene.g20870.t1.1
(894 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BU494229 similar to UniRef100_O48923 Cluster: Cytochrom... 174 6e-43
gnl|LJGI|BW596171 similar to UniRef100_Q2MJ16 Cluster: Cytochrom... 76 4e-13
gnl|LJGI|TC80462 similar to UniRef100_O48923 Cluster: Cytochrome... 70 3e-11
gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Ch... 52 6e-06
>gnl|LJGI|BU494229 similar to UniRef100_O48923 Cluster: Cytochrome P450 71D10; n=1;
Glycine max|Rep: Cytochrome P450 71D10 - Glycine max
(Soybean), partial (21%)
Length = 398
Score = 174 bits (88), Expect = 6e-43
Identities = 193/228 (84%)
Strand = Plus / Plus
Query: 241 caatatgccttgactgatgacaacattaaagctgttatcctggacttgttcgtcgctggt 300
|||||||| |||||||||||||| ||||||| || || | |||| |||||| || |||
Sbjct: 122 caatatgctttgactgatgacaatcttaaagcagtcattcaggacatgttcgctgccggt 181
Query: 301 ggagaaacagtttcgggggttgtgttgtgggggatgtcagaaatggtaaagaacccaaag 360
||||||||| |||| | ||||||| | |||| ||||||||||||||||| ||| ||||||
Sbjct: 182 ggagaaacaatttcagaggttgtgctttgggtgatgtcagaaatggtaaggaatccaaag 241
Query: 361 gtgatgaaaaaagcacaagcagaggtaagaagggtgtttgataacaaggggaatgtggat 420
|||||| || |||||||||| || ||||||||||||||||||| ||||||| ||||||||
Sbjct: 242 gtgatggaagaagcacaagctgaagtaagaagggtgtttgataccaagggggatgtggat 301
Query: 421 gaggaagacttgcaccagttggtatacttgaagtctgtcattaaagaa 468
|| ||| ||||||| ||| ||||||| |||| |||||| ||||||
Sbjct: 302 gaaacagagatgcaccaattgatatacttaaagtgtgtcatcaaagaa 349
>gnl|LJGI|BW596171 similar to UniRef100_Q2MJ16 Cluster: Cytochrome P450 monooxygenase
CYP71D64; n=1; Medicago truncatula|Rep: Cytochrome P450
monooxygenase CYP71D64 - Medicago truncatula (Barrel
medic), partial (29%)
Length = 481
Score = 75.8 bits (38), Expect = 4e-13
Identities = 77/90 (85%)
Strand = Plus / Minus
Query: 334 atgtcagaaatggtaaagaacccaaaggtgatgaaaaaagcacaagcagaggtaagaagg 393
|||||||||||||| || ||||||||||||| || |||||||||||||||| ||||||
Sbjct: 395 atgtcagaaatggtgaaagccccaaaggtgatggaacaagcacaagcagaggtgagaagg 336
Query: 394 gtgtttgataacaaggggaatgtggatgag 423
|| |||| | |||||| |||||||||||
Sbjct: 335 gtttttggtccaaaggggcatgtggatgag 306
>gnl|LJGI|TC80462 similar to UniRef100_O48923 Cluster: Cytochrome P450 71D10; n=1;
Glycine max|Rep: Cytochrome P450 71D10 - Glycine max
(Soybean), partial (12%)
Length = 430
Score = 69.9 bits (35), Expect = 3e-11
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 763 ctttaccactttgattgggagcttcccaatggaatgaaaagtgaagaacttgacatgact 822
||||||| |||||||||| |||||||| |||| ||||| | ||||||| | |||||||||
Sbjct: 164 ctttacccctttgattggaagcttccccatggcatgaagaatgaagaaatcgacatgact 223
Query: 823 gagttatttgg 833
|||| ||||||
Sbjct: 224 gagtcatttgg 234
>gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Chromosome chr19
scaffold_66, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr19 scaffold_66, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (36%)
Length = 914
Score = 52.0 bits (26), Expect = 6e-06
Identities = 56/66 (84%)
Strand = Plus / Minus
Query: 769 cactttgattgggagcttcccaatggaatgaaaagtgaagaacttgacatgactgagtta 828
|||||||||||| | || ||||||||||||||| |||| || | |||||||||||| |
Sbjct: 456 cactttgattggaacctgcccaatggaatgaaatgtgaggagttggacatgactgagcaa 397
Query: 829 tttgga 834
||||||
Sbjct: 396 tttgga 391