Miyakogusa Predicted Gene

Lj0g3v0268969.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0268969.1 tr|G7JZQ3|G7JZQ3_MEDTR Cytochrome P450
OS=Medicago truncatula GN=MTR_5g073320 PE=3
SV=1,65.77,0,p450,Cytochrome P450; CYTOCHROME_P450,Cytochrome P450,
conserved site; EP450I,Cytochrome P450, E-cla,gene.g20870.t1.1
         (894 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BU494229 similar to UniRef100_O48923 Cluster: Cytochrom...   174   6e-43
gnl|LJGI|BW596171 similar to UniRef100_Q2MJ16 Cluster: Cytochrom...    76   4e-13
gnl|LJGI|TC80462 similar to UniRef100_O48923 Cluster: Cytochrome...    70   3e-11
gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Ch...    52   6e-06

>gnl|LJGI|BU494229 similar to UniRef100_O48923 Cluster: Cytochrome P450 71D10; n=1;
           Glycine max|Rep: Cytochrome P450 71D10 - Glycine max
           (Soybean), partial (21%)
          Length = 398

 Score =  174 bits (88), Expect = 6e-43
 Identities = 193/228 (84%)
 Strand = Plus / Plus

                                                                       
Query: 241 caatatgccttgactgatgacaacattaaagctgttatcctggacttgttcgtcgctggt 300
           |||||||| ||||||||||||||  ||||||| || || | |||| ||||||  || |||
Sbjct: 122 caatatgctttgactgatgacaatcttaaagcagtcattcaggacatgttcgctgccggt 181

                                                                       
Query: 301 ggagaaacagtttcgggggttgtgttgtgggggatgtcagaaatggtaaagaacccaaag 360
           ||||||||| |||| | ||||||| | |||| ||||||||||||||||| ||| ||||||
Sbjct: 182 ggagaaacaatttcagaggttgtgctttgggtgatgtcagaaatggtaaggaatccaaag 241

                                                                       
Query: 361 gtgatgaaaaaagcacaagcagaggtaagaagggtgtttgataacaaggggaatgtggat 420
           |||||| || |||||||||| || ||||||||||||||||||| ||||||| ||||||||
Sbjct: 242 gtgatggaagaagcacaagctgaagtaagaagggtgtttgataccaagggggatgtggat 301

                                                           
Query: 421 gaggaagacttgcaccagttggtatacttgaagtctgtcattaaagaa 468
           ||   |||  ||||||| ||| ||||||| |||| |||||| ||||||
Sbjct: 302 gaaacagagatgcaccaattgatatacttaaagtgtgtcatcaaagaa 349


>gnl|LJGI|BW596171 similar to UniRef100_Q2MJ16 Cluster: Cytochrome P450 monooxygenase
           CYP71D64; n=1; Medicago truncatula|Rep: Cytochrome P450
           monooxygenase CYP71D64 - Medicago truncatula (Barrel
           medic), partial (29%)
          Length = 481

 Score = 75.8 bits (38), Expect = 4e-13
 Identities = 77/90 (85%)
 Strand = Plus / Minus

                                                                       
Query: 334 atgtcagaaatggtaaagaacccaaaggtgatgaaaaaagcacaagcagaggtaagaagg 393
           |||||||||||||| ||   ||||||||||||| || |||||||||||||||| ||||||
Sbjct: 395 atgtcagaaatggtgaaagccccaaaggtgatggaacaagcacaagcagaggtgagaagg 336

                                         
Query: 394 gtgtttgataacaaggggaatgtggatgag 423
           || |||| |   |||||| |||||||||||
Sbjct: 335 gtttttggtccaaaggggcatgtggatgag 306


>gnl|LJGI|TC80462 similar to UniRef100_O48923 Cluster: Cytochrome P450 71D10; n=1;
           Glycine max|Rep: Cytochrome P450 71D10 - Glycine max
           (Soybean), partial (12%)
          Length = 430

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 763 ctttaccactttgattgggagcttcccaatggaatgaaaagtgaagaacttgacatgact 822
           ||||||| |||||||||| |||||||| |||| ||||| | ||||||| | |||||||||
Sbjct: 164 ctttacccctttgattggaagcttccccatggcatgaagaatgaagaaatcgacatgact 223

                      
Query: 823 gagttatttgg 833
           |||| ||||||
Sbjct: 224 gagtcatttgg 234


>gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Chromosome chr19
           scaffold_66, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_66, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (36%)
          Length = 914

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 769 cactttgattgggagcttcccaatggaatgaaaagtgaagaacttgacatgactgagtta 828
           |||||||||||| | || ||||||||||||||| |||| ||  | ||||||||||||  |
Sbjct: 456 cactttgattggaacctgcccaatggaatgaaatgtgaggagttggacatgactgagcaa 397

                 
Query: 829 tttgga 834
           ||||||
Sbjct: 396 tttgga 391