Miyakogusa Predicted Gene

Lj0g3v0268669.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0268669.1 Non Chatacterized Hit- tr|F6HCI9|F6HCI9_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,49.49,0.000000000000001,seg,NULL,CUFF.17751.1
         (429 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72246 homologue to UniRef100_A7QS17 Cluster: Chromoso...    70   1e-11

>gnl|LJGI|TC72246 homologue to UniRef100_A7QS17 Cluster: Chromosome undetermined
           scaffold_155, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_155,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (24%)
          Length = 1626

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 261 gaaagaaacctattctcccagggatcactttggtgagaatccaggcagctttgggaaaca 320
           ||||||||| |||||||  | |||||| |||||||||||| |||| | |  |||| ||||
Sbjct: 39  gaaagaaacttattctcataaggatcagtttggtgagaatacagggaacactggggaaca 98

                                              
Query: 321 aatttcagaagcacaattggatgaaggcctctacc 355
           || || |||||| ||||||||||| ||||||||||
Sbjct: 99  aaatttagaagctcaattggatgatggcctctacc 133