Miyakogusa Predicted Gene
- Lj0g3v0267429.3
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0267429.3 Non Chatacterized Hit- tr|I1N141|I1N141_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,76.47,0.0000005,RNGMNOXGNASE,Aromatic-ring hydroxylase-like;
SQUALENE MONOOXYGENASE,NULL; no description,NULL; FAD/N,CUFF.17655.3
(1392 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63518 similar to UniRef100_Q8GSM9 Cluster: Squalene m... 86 7e-16
gnl|LJGI|TC58216 similar to UniRef100_Q8GSM8 Cluster: Squalene m... 74 3e-12
gnl|LJGI|DC596850 similar to UniRef100_Q75W20 Cluster: Squalene ... 60 4e-08
gnl|LJGI|TC72101 homologue to UniRef100_Q2HY08 Cluster: Squalene... 60 4e-08
gnl|LJGI|GO036224 homologue to UniRef100_Q2HY08 Cluster: Squalen... 54 2e-06
gnl|LJGI|TC67852 similar to UniRef100_A7QGY6 Cluster: Chromosome... 52 1e-05
>gnl|LJGI|TC63518 similar to UniRef100_Q8GSM9 Cluster: Squalene monooxygenase 2; n=1;
Medicago truncatula|Rep: Squalene monooxygenase 2 -
Medicago truncatula (Barrel medic), partial (45%)
Length = 937
Score = 85.7 bits (43), Expect = 7e-16
Identities = 253/323 (78%)
Strand = Plus / Plus
Query: 313 gctcacacccttgccaaggatggaagacgtgtccatgttattgagagagacttgagagag 372
|||||||| || | |||||||||| | || || |||||||| || ||||| |||| |||
Sbjct: 377 gctcacactctcggcaaggatggacgtcgagtgcatgttatcgaaagagatctgagcgag 436
Query: 373 ccagacagaattgttggcgaacttctccagccaggagggtacctgaagctaattgaactg 432
|| ||| |||||||||| || | || || || || || || || || |||| ||||||
Sbjct: 437 cctgaccgaattgttggggagttgctacaacctgggggctatctcaaattaatagaactg 496
Query: 433 ggattacaagattgcgtggagcaaattgatgcacaaagggtgttgggatatgttcttttc 492
||| | ||||||| ||||||||||||||||| ||| | ||||| || |||| |||||||
Sbjct: 497 ggacttgaagattgtgtggagcaaattgatgctcaacgagtgtttggttatgctcttttc 556
Query: 493 aaggatggggagagtactaatcttccttatcccttgcaaaagtttcatgctgatgtgact 552
|| |||||| || |||| ||| ||||||||||| | |||||||| | ||||| ||
Sbjct: 557 aatgatgggaagcatactcgtctctcttatcccttggagaagtttcaatcagatgtttct 616
Query: 553 ggtaagagctttcataatgggcggtttatacagaggttgagagaaaaagctgctgctctc 612
|| | |||||||| ||||| || ||||| |||||| || |||| || ||||| | ||
Sbjct: 617 ggcagaagctttcacaatggccgttttattcagaggatgcgagagaaggctgcatccctt 676
Query: 613 cccaatgtacaaatggagcaagg 635
||||| |||||| ||||||||||
Sbjct: 677 cccaacgtacaattggagcaagg 699
Score = 71.9 bits (36), Expect = 1e-11
Identities = 78/92 (84%)
Strand = Plus / Plus
Query: 721 tatgctcccctcacaattgtttgtgatggctgtttctctaatctgcgtcactctctctgc 780
||||||||||| || ||||||||||||||||||||||| || ||||||| ||||| ||
Sbjct: 782 tatgctccccttaccattgtttgtgatggctgtttctcaaacctgcgtcgttctctgtgt 841
Query: 781 caccccaaggtagaagttccctcttgttttgt 812
|||| ||||| || |||| |||||||||||
Sbjct: 842 aaccctaaggttgatattccatcttgttttgt 873
>gnl|LJGI|TC58216 similar to UniRef100_Q8GSM8 Cluster: Squalene monooxygenase 1; n=1;
Medicago truncatula|Rep: Squalene monooxygenase 1 -
Medicago truncatula (Barrel medic), partial (59%)
Length = 1180
Score = 73.8 bits (37), Expect = 3e-12
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 736 attgtttgtgatggctgtttctctaatctgcgtcactctctctgccaccccaaggtagaa 795
||||||||||||||||||||||| || |||||| |||||| || | || ||||||||
Sbjct: 783 attgtttgtgatggctgtttctcaaacttgcgtcgctctctttgtaatcctaaggtagat 842
Query: 796 gttccctcttgttttgt 812
|||||||||||||||||
Sbjct: 843 gttccctcttgttttgt 859
>gnl|LJGI|DC596850 similar to UniRef100_Q75W20 Cluster: Squalene epoxidase; n=1; Panax
ginseng|Rep: Squalene epoxidase - Panax ginseng (Korean
ginseng), partial (35%)
Length = 566
Score = 60.0 bits (30), Expect = 4e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 871 gctgatccttcccctatcttattttatcctattagcagcactgagattcg 920
||||||||||| || ||||| ||||| || ||||||||||||||||||||
Sbjct: 187 gctgatccttctcccatcttgttttaccccattagcagcactgagattcg 236
>gnl|LJGI|TC72101 homologue to UniRef100_Q2HY08 Cluster: Squalene epoxidase; n=1;
Medicago sativa|Rep: Squalene epoxidase - Medicago sativa
(Alfalfa), partial (28%)
Length = 697
Score = 60.0 bits (30), Expect = 4e-08
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 1231 aatgatgcagcctcactgtgcagatatcttgaatccttttacaccttgcgcaag 1284
||||||||| || |||| |||| ||| |||||||||||||| ||||||||||||
Sbjct: 20 aatgatgcacccacactttgcaaataccttgaatccttttataccttgcgcaag 73
>gnl|LJGI|GO036224 homologue to UniRef100_Q2HY08 Cluster: Squalene epoxidase; n=1;
Medicago sativa|Rep: Squalene epoxidase - Medicago
sativa (Alfalfa), partial (20%)
Length = 647
Score = 54.0 bits (27), Expect = 2e-06
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 274 gtcatcattgtcggcgccggggtaactggttctgctcttgctcacacccttgccaaggat 333
||||||||||| || || ||||| ||||| | ||||||||| |||| |||| ||||||
Sbjct: 327 gtcatcattgttggtgctggggttgctggtgcagctcttgcttacacacttggaaaggat 386
Query: 334 ggaagacgtgtccatgttattgagagagacttgag 368
||||| || || ||||| ||||| || ||||||||
Sbjct: 387 ggaaggcgagtgcatgtgattgaaagggacttgag 421
>gnl|LJGI|TC67852 similar to UniRef100_A7QGY6 Cluster: Chromosome chr3 scaffold_95,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_95, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (24%)
Length = 616
Score = 52.0 bits (26), Expect = 1e-05
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 1293 aggtatcatatttcccatcatcaaggctgaaggagtgaggcaaacattcttccc 1346
||||||||| || ||||| ||||||||||||||||| || |||| ||||||||
Sbjct: 293 aggtatcattttccccattatcaaggctgaaggagtaagacaaatgttcttccc 346