Miyakogusa Predicted Gene

Lj0g3v0267429.3
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0267429.3 Non Chatacterized Hit- tr|I1N141|I1N141_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,76.47,0.0000005,RNGMNOXGNASE,Aromatic-ring hydroxylase-like;
SQUALENE MONOOXYGENASE,NULL; no description,NULL; FAD/N,CUFF.17655.3
         (1392 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63518 similar to UniRef100_Q8GSM9 Cluster: Squalene m...    86   7e-16
gnl|LJGI|TC58216 similar to UniRef100_Q8GSM8 Cluster: Squalene m...    74   3e-12
gnl|LJGI|DC596850 similar to UniRef100_Q75W20 Cluster: Squalene ...    60   4e-08
gnl|LJGI|TC72101 homologue to UniRef100_Q2HY08 Cluster: Squalene...    60   4e-08
gnl|LJGI|GO036224 homologue to UniRef100_Q2HY08 Cluster: Squalen...    54   2e-06
gnl|LJGI|TC67852 similar to UniRef100_A7QGY6 Cluster: Chromosome...    52   1e-05

>gnl|LJGI|TC63518 similar to UniRef100_Q8GSM9 Cluster: Squalene monooxygenase 2; n=1;
           Medicago truncatula|Rep: Squalene monooxygenase 2 -
           Medicago truncatula (Barrel medic), partial (45%)
          Length = 937

 Score = 85.7 bits (43), Expect = 7e-16
 Identities = 253/323 (78%)
 Strand = Plus / Plus

                                                                       
Query: 313 gctcacacccttgccaaggatggaagacgtgtccatgttattgagagagacttgagagag 372
           |||||||| || | |||||||||| | || || |||||||| || |||||  |||| |||
Sbjct: 377 gctcacactctcggcaaggatggacgtcgagtgcatgttatcgaaagagatctgagcgag 436

                                                                       
Query: 373 ccagacagaattgttggcgaacttctccagccaggagggtacctgaagctaattgaactg 432
           || ||| |||||||||| ||  | || || || || || || || ||  |||| ||||||
Sbjct: 437 cctgaccgaattgttggggagttgctacaacctgggggctatctcaaattaatagaactg 496

                                                                       
Query: 433 ggattacaagattgcgtggagcaaattgatgcacaaagggtgttgggatatgttcttttc 492
           ||| |  ||||||| ||||||||||||||||| ||| | ||||| || |||| |||||||
Sbjct: 497 ggacttgaagattgtgtggagcaaattgatgctcaacgagtgtttggttatgctcttttc 556

                                                                       
Query: 493 aaggatggggagagtactaatcttccttatcccttgcaaaagtttcatgctgatgtgact 552
           || |||||| ||  ||||  |||  ||||||||||| | ||||||||  | |||||  ||
Sbjct: 557 aatgatgggaagcatactcgtctctcttatcccttggagaagtttcaatcagatgtttct 616

                                                                       
Query: 553 ggtaagagctttcataatgggcggtttatacagaggttgagagaaaaagctgctgctctc 612
           || |  |||||||| ||||| || ||||| |||||| || |||| || |||||  | || 
Sbjct: 617 ggcagaagctttcacaatggccgttttattcagaggatgcgagagaaggctgcatccctt 676

                                  
Query: 613 cccaatgtacaaatggagcaagg 635
           ||||| |||||| ||||||||||
Sbjct: 677 cccaacgtacaattggagcaagg 699



 Score = 71.9 bits (36), Expect = 1e-11
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 721 tatgctcccctcacaattgtttgtgatggctgtttctctaatctgcgtcactctctctgc 780
           ||||||||||| || ||||||||||||||||||||||| || |||||||  ||||| || 
Sbjct: 782 tatgctccccttaccattgtttgtgatggctgtttctcaaacctgcgtcgttctctgtgt 841

                                           
Query: 781 caccccaaggtagaagttccctcttgttttgt 812
            |||| ||||| ||  |||| |||||||||||
Sbjct: 842 aaccctaaggttgatattccatcttgttttgt 873


>gnl|LJGI|TC58216 similar to UniRef100_Q8GSM8 Cluster: Squalene monooxygenase 1; n=1;
           Medicago truncatula|Rep: Squalene monooxygenase 1 -
           Medicago truncatula (Barrel medic), partial (59%)
          Length = 1180

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 736 attgtttgtgatggctgtttctctaatctgcgtcactctctctgccaccccaaggtagaa 795
           ||||||||||||||||||||||| ||  |||||| |||||| ||  | || |||||||| 
Sbjct: 783 attgtttgtgatggctgtttctcaaacttgcgtcgctctctttgtaatcctaaggtagat 842

                            
Query: 796 gttccctcttgttttgt 812
           |||||||||||||||||
Sbjct: 843 gttccctcttgttttgt 859


>gnl|LJGI|DC596850 similar to UniRef100_Q75W20 Cluster: Squalene epoxidase; n=1; Panax
           ginseng|Rep: Squalene epoxidase - Panax ginseng (Korean
           ginseng), partial (35%)
          Length = 566

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 871 gctgatccttcccctatcttattttatcctattagcagcactgagattcg 920
           ||||||||||| || ||||| ||||| || ||||||||||||||||||||
Sbjct: 187 gctgatccttctcccatcttgttttaccccattagcagcactgagattcg 236


>gnl|LJGI|TC72101 homologue to UniRef100_Q2HY08 Cluster: Squalene epoxidase; n=1;
            Medicago sativa|Rep: Squalene epoxidase - Medicago sativa
            (Alfalfa), partial (28%)
          Length = 697

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                  
Query: 1231 aatgatgcagcctcactgtgcagatatcttgaatccttttacaccttgcgcaag 1284
            ||||||||| || |||| |||| ||| |||||||||||||| ||||||||||||
Sbjct: 20   aatgatgcacccacactttgcaaataccttgaatccttttataccttgcgcaag 73


>gnl|LJGI|GO036224 homologue to UniRef100_Q2HY08 Cluster: Squalene epoxidase; n=1;
           Medicago sativa|Rep: Squalene epoxidase - Medicago
           sativa (Alfalfa), partial (20%)
          Length = 647

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 gtcatcattgtcggcgccggggtaactggttctgctcttgctcacacccttgccaaggat 333
           ||||||||||| || || |||||  ||||| | ||||||||| |||| ||||  ||||||
Sbjct: 327 gtcatcattgttggtgctggggttgctggtgcagctcttgcttacacacttggaaaggat 386

                                              
Query: 334 ggaagacgtgtccatgttattgagagagacttgag 368
           ||||| || || ||||| ||||| || ||||||||
Sbjct: 387 ggaaggcgagtgcatgtgattgaaagggacttgag 421


>gnl|LJGI|TC67852 similar to UniRef100_A7QGY6 Cluster: Chromosome chr3 scaffold_95,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr3 scaffold_95, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (24%)
          Length = 616

 Score = 52.0 bits (26), Expect = 1e-05
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 1293 aggtatcatatttcccatcatcaaggctgaaggagtgaggcaaacattcttccc 1346
            ||||||||| || ||||| ||||||||||||||||| || ||||  ||||||||
Sbjct: 293  aggtatcattttccccattatcaaggctgaaggagtaagacaaatgttcttccc 346