Miyakogusa Predicted Gene

Lj0g3v0266969.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0266969.1 tr|G7KZX2|G7KZX2_MEDTR Receptor-like kinase
OS=Medicago truncatula GN=MTR_7g009970 PE=4
SV=1,76.97,0,Serine/Threonine protein kinases,
catalytic,Serine/threonine- / dual-specificity protein kinase,
cat,CUFF.17615.1
         (921 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62983                                                       52   6e-06

>gnl|LJGI|TC62983 
          Length = 695

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 590 gtgatgtttatagctttggagttgtg 615
           ||||||||||||||||||||||||||
Sbjct: 272 gtgatgtttatagctttggagttgtg 297