Miyakogusa Predicted Gene

Lj0g3v0266719.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0266719.1 tr|G8Y3Q9|G8Y3Q9_PICSO Piso0_004915 protein
OS=Pichia sorbitophila (strain ATCC MYA-4447 / BCRC
2208,35.29,2.6,seg,NULL,CUFF.17593.1
         (366 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW626340 similar to UniRef100_Q39871 Cluster: Maturatio...    88   4e-17

>gnl|LJGI|BW626340 similar to UniRef100_Q39871 Cluster: Maturation polypeptide; n=2;
           Glycine max|Rep: Maturation polypeptide - Glycine max
           (Soybean), partial (15%)
          Length = 489

 Score = 87.7 bits (44), Expect = 4e-17
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                       
Query: 1   atgatacttcctctgccactactaacaaagcaggttccaaggtt 44
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 435 atgatacttcctctgccactactaacaaagcaggttccaaggtt 478