Miyakogusa Predicted Gene

Lj0g3v0262779.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0262779.1 tr|G8A366|G8A366_MEDTR Flavonoid 3'
5'-hydroxylase OS=Medicago truncatula GN=MTR_144s0021 PE=3
SV=1,78.28,0,EP450I,Cytochrome P450, E-class, group I; P450,Cytochrome
P450; p450,Cytochrome P450; FAMILY NOT NAM,CUFF.17304.1
         (1401 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69972 similar to UniRef100_A5Y5L3 Cluster: Flavonoid ...    64   3e-09
gnl|LJGI|TC75558 similar to UniRef100_Q6YLS3 Cluster: Flavonoid ...    62   1e-08

>gnl|LJGI|TC69972 similar to UniRef100_A5Y5L3 Cluster: Flavonoid 3'5' hydroxylase;
           n=1; Glycine max|Rep: Flavonoid 3'5' hydroxylase -
           Glycine max (Soybean), partial (35%)
          Length = 586

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgccttatgtcacactcacaaacatgcctaagaaatttgggcccatcatgttcctcaaa 60
           |||||| ||||||||||| |||||||| |||| |||| ||| ||  |||||| |||||||
Sbjct: 196 atgcctcatgtcacactctcaaacatggctaaaaaatatggacctgtcatgtacctcaaa 255

                   
Query: 61  atgggcac 68
           ||||||||
Sbjct: 256 atgggcac 263


>gnl|LJGI|TC75558 similar to UniRef100_Q6YLS3 Cluster: Flavonoid 3', 5'-hydroxylase;
            n=1; Glycine max|Rep: Flavonoid 3', 5'-hydroxylase -
            Glycine max (Soybean), partial (24%)
          Length = 589

 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1001 acattcccaagaatacaaggctaaatgtgaatatttgggccatagggagagaccctaatg 1060
            |||| |||||||| |||||||| |||||||| || ||||||||||| || |||||| | |
Sbjct: 1    acatccccaagaacacaaggctgaatgtgaacatatgggccataggaagggaccctgacg 60

                   
Query: 1061 tgtggga 1067
            |||||||
Sbjct: 61   tgtggga 67



 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 1211 agtacattttgggcactttggtgcactcttttgattggaag 1251
            ||||||||||||| ||||||||||| |||| ||||||||||
Sbjct: 211  agtacattttggggactttggtgcattcttatgattggaag 251