Miyakogusa Predicted Gene

Lj0g3v0259359.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0259359.1 Non Chatacterized Hit- tr|J3L6U8|J3L6U8_ORYBR
Uncharacterized protein OS=Oryza brachyantha GN=OB01G4,86,2e-16,
,CUFF.17088.1
         (783 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP041750 similar to UniRef100_Q2VY14 Cluster: CONSTANS ...   458   e-128

>gnl|LJGI|BP041750 similar to UniRef100_Q2VY14 Cluster: CONSTANS interacting protein
           5; n=1; Solanum lycopersicum|Rep: CONSTANS interacting
           protein 5 - Solanum lycopersicum (Tomato) (Lycopersicon
           esculentum), partial (11%)
          Length = 539

 Score =  458 bits (231), Expect = e-128
 Identities = 231/231 (100%)
 Strand = Plus / Minus

                                                                       
Query: 499 gtgccgccgcgcgattggccgccgcaagggtgggaggtggaccgggaggagctggcgtat 558
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 539 gtgccgccgcgcgattggccgccgcaagggtgggaggtggaccgggaggagctggcgtat 480

                                                                       
Query: 559 attcgggaggcgcataaaatgcaggccaagagggtcagtgtggaggagattgagaatgga 618
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 attcgggaggcgcataaaatgcaggccaagagggtcagtgtggaggagattgagaatgga 420

                                                                       
Query: 619 gtgaggactgaaactgatgatgtgtgcttggataggtacaaggtgtttctgaagcagtac 678
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 gtgaggactgaaactgatgatgtgtgcttggataggtacaaggtgtttctgaagcagtac 360

                                                              
Query: 679 aaggagtgggtggaggcaaacaaggatagattggaggaggagtcttacgag 729
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 359 aaggagtgggtggaggcaaacaaggatagattggaggaggagtcttacgag 309