Miyakogusa Predicted Gene

Lj0g3v0258989.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0258989.1 tr|G7LJ94|G7LJ94_MEDTR 6-phosphofructokinase
OS=Medicago truncatula GN=MTR_8g069040 PE=4 SV=1,87.43,0,seg,NULL;
Phosphofructokinase,Phosphofructokinase domain; no description,NULL;
PHFRCTKINASE,Phosphof,CUFF.17062.1
         (1596 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72776 similar to UniRef100_A7R0K1 Cluster: Chromosome...   315   5e-85

>gnl|LJGI|TC72776 similar to UniRef100_A7R0K1 Cluster: Chromosome undetermined
            scaffold_310, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_310, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (10%)
          Length = 609

 Score =  315 bits (159), Expect = 5e-85
 Identities = 159/159 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1438 gcatttgcaggatacagtggcattacagtaggcttatgcaacactcactatgcttatttt 1497
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    gcatttgcaggatacagtggcattacagtaggcttatgcaacactcactatgcttatttt 60

                                                                        
Query: 1498 cccatcccagaagtaatatctcatcccagattggtggaccctaacagtcgaatgtggcat 1557
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   cccatcccagaagtaatatctcatcccagattggtggaccctaacagtcgaatgtggcat 120

                                                   
Query: 1558 cgttgcttaacttcaacagggcaacctgacttcatttga 1596
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 121  cgttgcttaacttcaacagggcaacctgacttcatttga 159