Miyakogusa Predicted Gene

Lj0g3v0258459.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0258459.3 Non Chatacterized Hit- tr|Q8GXL0|Q8GXL0_ARATH
Putative villin 1 VLN1 OS=Arabidopsis thaliana
GN=At2g,30.48,0.004,seg,NULL; GELSOLIN,Gelsolin; no description,NULL;
Gelsolin homology domain,Gelsolin; VILLIN 1-4,NULL,CUFF.17403.3
         (465 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP069941 similar to UniRef100_Q9SQH4 Cluster: Actin bun...   315   1e-85

>gnl|LJGI|BP069941 similar to UniRef100_Q9SQH4 Cluster: Actin bundling protein ABP135;
           n=1; Lilium longiflorum|Rep: Actin bundling protein
           ABP135 - Lilium longiflorum (Trumpet lily), partial
           (10%)
          Length = 304

 Score =  315 bits (159), Expect = 1e-85
 Identities = 249/279 (89%)
 Strand = Plus / Plus

                                                                       
Query: 51  agaggaggtttacaacttttcccaagatgatttgttaacggaggatatcctaatacttga 110
           |||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||
Sbjct: 24  agaggaggtttacaacttttcccaggatgatttgttaacagaggacatcctaatacttga 83

                                                                       
Query: 111 cacacatgcagaagtgtttatttggattggtcactctgttgacccaaaagaaaagcaaaa 170
           ||| ||||| ||||||||| ||||||| ||||| ||||| ||| | ||||||||||||||
Sbjct: 84  cacgcatgctgaagtgtttgtttggatcggtcagtctgtggacactaaagaaaagcaaaa 143

                                                                       
Query: 171 tacttttgaaattggccagaaatacatagacatggctgcatctctggagggactatctct 230
           | |||||||||||| |||||||||||| || | |||| |||||||||| || || |||| 
Sbjct: 144 tgcttttgaaattgcccagaaatacattgataaggctacatctctggaagggctttctcc 203

                                                                       
Query: 231 gcatgtaccgttatataaagtaacagaagggaatgaaccttgctttttcacaacatactt 290
            ||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 tcatgtacctctgtataaagtaacagaagggaatgaaccttgctttttcacaacatactt 263

                                                  
Query: 291 ttcatgggatcatgcaaaagctttgattcagggaaactc 329
           ||| ||||||||||||||||||  | ||||||| |||||
Sbjct: 264 ttcttgggatcatgcaaaagctacggttcaggggaactc 302