Miyakogusa Predicted Gene

Lj0g3v0254329.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0254329.1 tr|G7K3J1|G7K3J1_MEDTR
TIR-similar-domain-containing protein TSDC OS=Medicago truncatula
GN=MTR_5g09,41.13,3e-18,coiled-coil,NULL; seg,NULL,CUFF.16724.1
         (549 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78835 similar to UniRef100_A8VXI4 Cluster: Envelope g...    66   2e-10

>gnl|LJGI|TC78835 similar to UniRef100_A8VXI4 Cluster: Envelope glycoprotein; n=1;
           Human immunodeficiency virus 1|Rep: Envelope
           glycoprotein - Human immunodeficiency virus 1, partial
           (7%)
          Length = 663

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgtgctggaaaaggttgaagctatgaagaaaacagaaaaagtcaatgatgttgttctgaa 173
           ||||||| ||| |||||||| ||  || | |||||||||||||||||||| |||| || |
Sbjct: 183 tgtgctgaaaatggttgaagatacaaacagaacagaaaaagtcaatgatgctgttatgga 242

                                                
Query: 174 gtggctaaaagaagcagagaagctcatagaagaggag 210
           |||| |||| || || || || |||||||||||||||
Sbjct: 243 gtggttaaatgatgccgaaaaactcatagaagaggag 279