Miyakogusa Predicted Gene

Lj0g3v0251449.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0251449.1 CUFF.16478.1
         (351 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67565 homologue to UniRef100_P35055 Cluster: Copropor...    52   2e-06
gnl|LJGI|TC66607 homologue to UniRef100_P35055 Cluster: Copropor...    52   2e-06

>gnl|LJGI|TC67565 homologue to UniRef100_P35055 Cluster: Coproporphyrinogen III
           oxidase, chloroplast precursor; n=1; Glycine max|Rep:
           Coproporphyrinogen III oxidase, chloroplast precursor -
           Glycine max (Soybean), partial (51%)
          Length = 892

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 156 gtgcaaattctgttgttccagcttatatacctat 189
           |||||||||||||||||||  |||||||||||||
Sbjct: 306 gtgcaaattctgttgttccttcttatatacctat 339


>gnl|LJGI|TC66607 homologue to UniRef100_P35055 Cluster: Coproporphyrinogen III
            oxidase, chloroplast precursor; n=1; Glycine max|Rep:
            Coproporphyrinogen III oxidase, chloroplast precursor -
            Glycine max (Soybean), partial (88%)
          Length = 1667

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 156  gtgcaaattctgttgttccagcttatatacctat 189
            |||||||||||||||||||  |||||||||||||
Sbjct: 981  gtgcaaattctgttgttccttcttatatacctat 1014