Miyakogusa Predicted Gene

Lj0g3v0250929.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0250929.1 Non Chatacterized Hit- tr|I1MLX8|I1MLX8_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,35.81,5e-18,
,CUFF.16432.1
         (445 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO023264 similar to UniRef100_O16505 Cluster: Serpentin...    56   2e-07

>gnl|LJGI|GO023264 similar to UniRef100_O16505 Cluster: Serpentine receptor, class t
           protein 65; n=1; Caenorhabditis elegans|Rep: Serpentine
           receptor, class t protein 65 - Caenorhabditis elegans,
           partial (6%)
          Length = 525

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 352 tattggtcagtgagaactgatggtgtgtatcacagc 387
           |||||||||||||||| ||||||| |||||||||||
Sbjct: 392 tattggtcagtgagaattgatggtttgtatcacagc 427