Miyakogusa Predicted Gene

Lj0g3v0250689.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0250689.1 Non Chatacterized Hit- tr|D8RSN4|D8RSN4_SELML
Putative uncharacterized protein OS=Selaginella
moelle,32.35,1.8,AAA,ATPase, AAA-type, core; AAA-FAMILY ATPASE,NULL;
AAA ATPASE,NULL; coiled-coil,NULL; seg,NULL; P-l,CUFF.16418.1
         (555 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP036557 similar to UniRef100_A7PHF9 Cluster: Chromosom...   163   1e-39
gnl|LJGI|AV418768 homologue to UniRef100_A7PHF9 Cluster: Chromos...    56   2e-07

>gnl|LJGI|BP036557 similar to UniRef100_A7PHF9 Cluster: Chromosome chr17 scaffold_16,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr17 scaffold_16, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (10%)
          Length = 369

 Score =  163 bits (82), Expect = 1e-39
 Identities = 85/86 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagtgtgaaggacttgatacattgtgtattaaggatcagacagttacaaatgaaaat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 atggagtgtgaaggacttgatacattgtgtattaaggatcagacagttacaaatgaaaat 343

                                     
Query: 61  gcagagaagatagttggttgggcttt 86
           ||||||||| ||||||||||||||||
Sbjct: 344 gcagagaaggtagttggttgggcttt 369


>gnl|LJGI|AV418768 homologue to UniRef100_A7PHF9 Cluster: Chromosome chr17
           scaffold_16, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_16, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (7%)
          Length = 260

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 424 tttggtccacctggaacaggtaaaacaatgcttgcaaaggcaattgctactgaggccagt 483
           ||||| || ||||| ||||| ||||||||||||||||||||  | || ||||| ||  | 
Sbjct: 99  tttgggcctcctggcacaggcaaaacaatgcttgcaaaggctgtagcaactgaagcagga 158

                                           
Query: 484 gcaaatttcattaacatttccatgtcaagcat 515
           || ||||||||||| ||||| ||||| |||||
Sbjct: 159 gcgaatttcattaatatttctatgtccagcat 190