Miyakogusa Predicted Gene

Lj0g3v0250479.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0250479.1 Non Chatacterized Hit- tr|F8PRD6|F8PRD6_SERL3
Putative uncharacterized protein OS=Serpula lacrymans
,42.31,1.4,seg,NULL,CUFF.16396.1
         (339 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS325217 similar to UniRef100_A1DR83 Cluster: AT-hook D...    86   2e-16
gnl|LJGI|TC73875 similar to UniRef100_A1DR83 Cluster: AT-hook DN...    86   2e-16
gnl|LJGI|DC600101 similar to UniRef100_Q1K0C9 Cluster: TonB-like...    60   9e-09
gnl|LJGI|TC77750 similar to UniRef100_Q9S740 Cluster: Lysine-ric...    60   9e-09
gnl|LJGI|TC70421 similar to UniRef100_A7QEK6 Cluster: Chromosome...    60   9e-09
gnl|LJGI|TC60345 similar to UniRef100_A7PIQ5 Cluster: Chromosome...    50   9e-06

>gnl|LJGI|FS325217 similar to UniRef100_A1DR83 Cluster: AT-hook DNA-binding protein;
           n=1; Catharanthus roseus|Rep: AT-hook DNA-binding
           protein - Catharanthus roseus (Rosy periwinkle)
           (Madagascar periwinkle), partial (17%)
          Length = 813

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 8   tgaggagcgcgttggggctctccttggttatcaccaccggcggcttc 54
           |||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 tgagaagcgcgttggggctctccttggttatcaccaccggcggcttc 702


>gnl|LJGI|TC73875 similar to UniRef100_A1DR83 Cluster: AT-hook DNA-binding protein;
           n=1; Catharanthus roseus|Rep: AT-hook DNA-binding
           protein - Catharanthus roseus (Rosy periwinkle)
           (Madagascar periwinkle), partial (27%)
          Length = 520

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 46/47 (97%)
 Strand = Plus / Minus

                                                          
Query: 8   tgaggagcgcgttggggctctccttggttatcaccaccggcggcttc 54
           |||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 358 tgagaagcgcgttggggctctccttggttatcaccaccggcggcttc 312


>gnl|LJGI|DC600101 similar to UniRef100_Q1K0C9 Cluster: TonB-like; n=1; Desulfuromonas
           acetoxidans DSM 684|Rep: TonB-like - Desulfuromonas
           acetoxidans DSM 684, partial (9%)
          Length = 548

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 53  tcaaccacctcaacccagaaatcctgaaaatccc 86
           ||||||||||||||||||||||| ||||||||||
Sbjct: 372 tcaaccacctcaacccagaaatcatgaaaatccc 339


>gnl|LJGI|TC77750 similar to UniRef100_Q9S740 Cluster: Lysine-rich arabinogalactan
           protein 19 precursor; n=1; Arabidopsis thaliana|Rep:
           Lysine-rich arabinogalactan protein 19 precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (12%)
          Length = 638

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 53  tcaaccacctcaacccagaaatcctgaaaatccc 86
           ||||||||||||||||||||||| ||||||||||
Sbjct: 325 tcaaccacctcaacccagaaatcatgaaaatccc 292


>gnl|LJGI|TC70421 similar to UniRef100_A7QEK6 Cluster: Chromosome chr17 scaffold_85,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr17 scaffold_85, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (27%)
          Length = 748

 Score = 60.0 bits (30), Expect = 9e-09
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 249 aaggcggagagatcatcgagtggttgagcagcgccggggaaggcaagggg 298
           |||||||||||||||||||  ||||||| |||| |||||||||| |||||
Sbjct: 358 aaggcggagagatcatcgaacggttgagtagcggcggggaaggcgagggg 309


>gnl|LJGI|TC60345 similar to UniRef100_A7PIQ5 Cluster: Chromosome chr13 scaffold_17,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_17, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (28%)
          Length = 863

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 15  cgcgttggggctctccttggttatcaccaccgg 47
           ||||||||||||||||||||| ||||| |||||
Sbjct: 736 cgcgttggggctctccttggtaatcacaaccgg 704