Miyakogusa Predicted Gene
- Lj0g3v0248869.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0248869.1 Non Chatacterized Hit- tr|B9SL31|B9SL31_RICCO
Transcription factor, putative OS=Ricinus communis
GN=,53.95,0.00000000000002,WRKY,DNA-binding WRKY; DNA binding
domain,DNA-binding WRKY; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAM,CUFF.16254.1
(1116 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC593983 similar to UniRef100_O81639 Cluster: Zinc fing... 86 5e-16
gnl|LJGI|TC79677 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1... 86 5e-16
gnl|LJGI|TC69589 homologue to UniRef100_A7LHH7 Cluster: WRKY39; ... 84 2e-15
gnl|LJGI|TC64700 similar to UniRef100_A7LHH5 Cluster: WRKY35; n=... 84 2e-15
gnl|LJGI|TC71912 similar to UniRef100_A7QQF6 Cluster: Chromosome... 78 1e-13
gnl|LJGI|TC64786 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1... 78 1e-13
gnl|LJGI|TC61070 similar to UniRef100_Q40090 Cluster: SPF1 prote... 66 5e-10
>gnl|LJGI|DC593983 similar to UniRef100_O81639 Cluster: Zinc finger protein; n=1;
Pimpinella brachycarpa|Rep: Zinc finger protein -
Pimpinella brachycarpa, partial (26%)
Length = 587
Score = 85.7 bits (43), Expect = 5e-16
Identities = 82/95 (86%)
Strand = Plus / Plus
Query: 310 agtgaaatagacatacttgacgatggttatcgctggcggaagtatggacagaaagttgtc 369
||||| || ||||||||||| ||||| ||| | ||| | || ||||| |||||||||||
Sbjct: 485 agtgagattgacatacttgatgatggctataggtggagaaaatatgggcagaaagttgtt 544
Query: 370 aaaggaaatccaaacccaaggagctactacaaatg 404
|| ||||| ||||||||||||||||||||||||||
Sbjct: 545 aagggaaacccaaacccaaggagctactacaaatg 579
>gnl|LJGI|TC79677 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1; Glycine max|Rep:
WRKY5 - Glycine max (Soybean), partial (42%)
Length = 819
Score = 85.7 bits (43), Expect = 5e-16
Identities = 82/95 (86%)
Strand = Plus / Plus
Query: 310 agtgaaatagacatacttgacgatggttatcgctggcggaagtatggacagaaagttgtc 369
||||| || ||||||||||| ||||| ||| | ||| | || ||||| |||||||||||
Sbjct: 20 agtgagattgacatacttgatgatggctataggtggagaaaatatgggcagaaagttgtt 79
Query: 370 aaaggaaatccaaacccaaggagctactacaaatg 404
|| ||||| ||||||||||||||||||||||||||
Sbjct: 80 aagggaaacccaaacccaaggagctactacaaatg 114
>gnl|LJGI|TC69589 homologue to UniRef100_A7LHH7 Cluster: WRKY39; n=1; Glycine
max|Rep: WRKY39 - Glycine max (Soybean), partial (62%)
Length = 1146
Score = 83.8 bits (42), Expect = 2e-15
Identities = 126/154 (81%)
Strand = Plus / Plus
Query: 347 ggaagtatggacagaaagttgtcaaaggaaatccaaacccaaggagctactacaaatgca 406
|||| ||||| ||||||||||| || ||||||||||| |||||||| ||||| |||||||
Sbjct: 294 ggaaatatgggcagaaagttgtaaagggaaatccaaatccaaggagttactataaatgca 353
Query: 407 caagtgctggatgtcctgtaaggaaacatgtggaaagggcttcccataatctgaaatatg 466
|| | |||||||| || ||||| |||||||| || ||||| ||| |||| | | ||
Sbjct: 354 cacacccaggatgtccagtgaggaagcatgtggagagagcttcacatgatctaagagctg 413
Query: 467 ttatcactacttatgagggaaaacacaatcatga 500
| ||||| || ||||| ||||||||||| |||||
Sbjct: 414 tgatcacaacatatgaaggaaaacacaaccatga 447
>gnl|LJGI|TC64700 similar to UniRef100_A7LHH5 Cluster: WRKY35; n=1; Glycine max|Rep:
WRKY35 - Glycine max (Soybean), partial (53%)
Length = 888
Score = 83.8 bits (42), Expect = 2e-15
Identities = 138/170 (81%)
Strand = Plus / Plus
Query: 331 gatggttatcgctggcggaagtatggacagaaagttgtcaaaggaaatccaaacccaagg 390
||||| || |||||||| || ||||| ||||| || || | |||||||| |||||||||
Sbjct: 15 gatgggtaccgctggcgtaaatatgggcagaaggtggtgaggggaaatccgaacccaagg 74
Query: 391 agctactacaaatgcacaagtgctggatgtcctgtaaggaaacatgtggaaagggcttcc 450
||||| ||||| ||||||| |||||| || ||||| || ||||| ||||| ||||| ||
Sbjct: 75 agctattacaagtgcacaaatgctggttgccctgttagaaaacacgtggagagggcatct 134
Query: 451 cataatctgaaatatgttatcactacttatgagggaaaacacaatcatga 500
||| ||| |||| || || ||||| |||||||| |||||||| |||||
Sbjct: 135 catgatccgaaagcggtgataactacatatgagggtaaacacaaccatga 184
>gnl|LJGI|TC71912 similar to UniRef100_A7QQF6 Cluster: Chromosome undetermined
scaffold_142, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_142,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (31%)
Length = 991
Score = 77.8 bits (39), Expect = 1e-13
Identities = 147/183 (80%)
Strand = Plus / Plus
Query: 331 gatggttatcgctggcggaagtatggacagaaagttgtcaaaggaaatccaaacccaagg 390
|||||||| || |||||||| ||||| || |||||||| || |||||||| |||||||||
Sbjct: 210 gatggttaccgatggcggaaatatgggcaaaaagttgtaaagggaaatcccaacccaagg 269
Query: 391 agctactacaaatgcacaagtgctggatgtcctgtaaggaaacatgtggaaagggcttcc 450
|| |||||||| ||||| | ||||| || || ||||| |||||||| || || ||
Sbjct: 270 agttactacaagtgcaccaacgctgggtgcatggtgaggaagcatgtggagagagcatca 329
Query: 451 cataatctgaaatatgttatcactacttatgagggaaaacacaatcatgaagtgcctact 510
||| | || |||| ||| ||||| || ||||||||||| ||||| ||||| || ||| ||
Sbjct: 330 catgaccttaaatctgtgatcacgacctatgagggaaagcacaaccatgatgtccctgct 389
Query: 511 gct 513
|||
Sbjct: 390 gct 392
>gnl|LJGI|TC64786 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1; Glycine max|Rep:
WRKY5 - Glycine max (Soybean), partial (66%)
Length = 911
Score = 77.8 bits (39), Expect = 1e-13
Identities = 84/99 (84%)
Strand = Plus / Plus
Query: 310 agtgaaatagacatacttgacgatggttatcgctggcggaagtatggacagaaagttgtc 369
|||||||| || |||||||| ||||| ||| | ||| |||| |||||||||||||| ||
Sbjct: 222 agtgaaattgatatacttgatgatggctataggtggaggaaatatggacagaaagtagtt 281
Query: 370 aaaggaaatccaaacccaaggagctactacaaatgcaca 408
|| ||||| ||||| |||||||||| ||||||||||||
Sbjct: 282 aagggaaacccaaatgcaaggagctattacaaatgcaca 320
>gnl|LJGI|TC61070 similar to UniRef100_Q40090 Cluster: SPF1 protein; n=1; Ipomoea
batatas|Rep: SPF1 protein - Ipomoea batatas (Sweet
potato) (Batate), partial (41%)
Length = 1517
Score = 65.9 bits (33), Expect = 5e-10
Identities = 72/85 (84%)
Strand = Plus / Plus
Query: 325 cttgacgatggttatcgctggcggaagtatggacagaaagttgtcaaaggaaatccaaac 384
||||| ||||| || || ||| |||| ||||| |||||||| || || |||||||||||
Sbjct: 1242 cttgatgatggataccgatggaggaaatatgggcagaaagtagtaaagggaaatccaaat 1301
Query: 385 ccaaggagctactacaaatgcacaa 409
|||||||| |||||||| |||||||
Sbjct: 1302 ccaaggagttactacaagtgcacaa 1326