Miyakogusa Predicted Gene

Lj0g3v0246999.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0246999.1 Non Chatacterized Hit- tr|I1P3U7|I1P3U7_ORYGL
Uncharacterized protein OS=Oryza glaberrima PE=4 SV=1,39.53,3e-19,no
description,NULL; basic region leucin zipper,Basic-leucine zipper
domain; coiled-coil,NULL; BZIP,,CUFF.16127.1
         (607 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO035667 similar to UniRef100_Q0GPI4 Cluster: BZIP tran...   575   e-163
gnl|LJGI|TC73248 similar to UniRef100_Q0GPI4 Cluster: BZIP trans...   165   4e-40
gnl|LJGI|BP030440 similar to UniRef100_Q0GPI4 Cluster: BZIP tran...    76   3e-13
gnl|LJGI|TC69676 similar to UniRef100_Q0GPH2 Cluster: BZIP trans...    62   4e-09
gnl|LJGI|TC68736 similar to UniRef100_Q0GPH2 Cluster: BZIP trans...    60   2e-08
gnl|LJGI|TC78151 homologue to UniRef100_Q0GPF8 Cluster: BZIP tra...    52   4e-06

>gnl|LJGI|GO035667 similar to UniRef100_Q0GPI4 Cluster: BZIP transcription factor
           bZIP35; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP35 - Glycine max (Soybean), partial (52%)
          Length = 398

 Score =  575 bits (290), Expect = e-163
 Identities = 290/290 (100%)
 Strand = Plus / Plus

                                                                       
Query: 318 gaagcacttggatgaactctggtcccaggtagtcaggctcagaactgagaatcacaacct 377
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29  gaagcacttggatgaactctggtcccaggtagtcaggctcagaactgagaatcacaacct 88

                                                                       
Query: 378 tgttgatagactcaaccatgtgtctgagtcccatgacagagctcttcaagagaatgcacg 437
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 89  tgttgatagactcaaccatgtgtctgagtcccatgacagagctcttcaagagaatgcacg 148

                                                                       
Query: 438 cctcaaggaagaaacttctgatcttcgccgaatggtagcagacatgcaaattggaaactc 497
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 149 cctcaaggaagaaacttctgatcttcgccgaatggtagcagacatgcaaattggaaactc 208

                                                                       
Query: 498 ttttgcttgcaccatgagagattttgaggaaattccatgcaacacatctcaacttaaaga 557
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 ttttgcttgcaccatgagagattttgaggaaattccatgcaacacatctcaacttaaaga 268

                                                             
Query: 558 ggattcctcaaaccaatcaatcattccttcagacttggttcatgaatgaa 607
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 269 ggattcctcaaaccaatcaatcattccttcagacttggttcatgaatgaa 318



 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 230 agcttcagttcagagtaatcgacgaaaggaagcac 264
           |||||||||||||||||||||||||||||||||||
Sbjct: 1   agcttcagttcagagtaatcgacgaaaggaagcac 35


>gnl|LJGI|TC73248 similar to UniRef100_Q0GPI4 Cluster: BZIP transcription factor
           bZIP35; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP35 - Glycine max (Soybean), partial (22%)
          Length = 495

 Score =  165 bits (83), Expect = 4e-40
 Identities = 226/270 (83%), Gaps = 4/270 (1%)
 Strand = Plus / Minus

                                                                       
Query: 220 gaagcagatgagcttcagttcagagtaatcgacgaaaggaagcaccggcgaatgatatcg 279
           |||||| |||| |||||||||||| |||||| | ||||||||||| || ||||||| || 
Sbjct: 274 gaagcaaatgaacttcagttcaga-taatcggcaaaaggaagcacaggtgaatgatgtct 216

                                                                       
Query: 280 aaccgagaatccgcccgcagatcaaggatgaggaagcagaagcacttggatgaactctgg 339
           |||  ||  |  |||| |||||||||||||| |||||| ||||||||| | | ||| |||
Sbjct: 215 aacacagttt--gcccacagatcaaggatgaagaagcaaaagcacttgaacggactgtgg 158

                                                                       
Query: 340 tcccaggtagtcaggctcagaactgagaatcacaaccttgttgatagactcaaccatgtg 399
           ||  |||| ||||| ||  | | |||||| ||||||||||||  || |||||||||||||
Sbjct: 157 tcaaaggttgtcagacttggtattgagaaccacaaccttgttcttaaactcaaccatgtg 98

                                                                       
Query: 400 tctgagtcccatgacagagctcttcaagagaatgcacgcctcaaggaagaaacttctgat 459
           |||||||||||||||||||| | |||| |||| ||| |||| ||||||||||||| ||||
Sbjct: 97  tctgagtcccatgacagagc-cctcaatagaaggcatgccttaaggaagaaacttatgat 39

                                         
Query: 460 cttcgccgaatggtagcagacatgcaaatt 489
           || || | ||||||||||||||||||||||
Sbjct: 38  ctacgtcaaatggtagcagacatgcaaatt 9


>gnl|LJGI|BP030440 similar to UniRef100_Q0GPI4 Cluster: BZIP transcription factor
           bZIP35; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP35 - Glycine max (Soybean), partial (21%)
          Length = 536

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 499 tttgcttgcaccatgagagattttgaggaaattccatgcaacacatctcaacttaaag 556
           |||||||||||| || |||||||||||||  |||||||||||||||||||||| ||||
Sbjct: 408 tttgcttgcaccttgggagattttgaggagcttccatgcaacacatctcaactcaaag 465



 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 57/66 (86%), Gaps = 1/66 (1%)
 Strand = Plus / Plus

                                                                       
Query: 210 aacttctgacgaagcagatgagcttcagttcagagtaatcgacgaaaggaagcaccggcg 269
           ||||| ||| |||||| |||| |||||||||||| |||||||  ||||||||||| | ||
Sbjct: 253 aacttatgatgaagcaaatgaacttcagttcaga-taatcgataaaaggaagcacagacg 311

                 
Query: 270 aatgat 275
           ||||||
Sbjct: 312 aatgat 317


>gnl|LJGI|TC69676 similar to UniRef100_Q0GPH2 Cluster: BZIP transcription factor
           bZIP73B; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP73B - Glycine max (Soybean), partial (54%)
          Length = 1063

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgatatcgaaccgagaatccgcccgcagatcaaggatgaggaagcagaagcacttggat 330
           |||||||||||||||||||| || ||| | ||  |||||||||||||||||||| | |||
Sbjct: 325 atgatatcgaaccgagaatcagcgcgccggtcccggatgaggaagcagaagcaccttgat 384

                      
Query: 331 gaactctggtc 341
           || || |||||
Sbjct: 385 gagctttggtc 395


>gnl|LJGI|TC68736 similar to UniRef100_Q0GPH2 Cluster: BZIP transcription factor
           bZIP73B; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP73B - Glycine max (Soybean), partial (55%)
          Length = 608

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 271 atgatatcgaaccgagaatccgcccgcagatcaaggatgaggaagcagaagcacttggat 330
           |||||||| ||||||||||| || ||  ||||  | ||||||||||||| |||| | |||
Sbjct: 281 atgatatcaaaccgagaatcagcgcggcgatcgcgcatgaggaagcagaggcaccttgat 340

                                                     
Query: 331 gaactctggtcccaggtagtcaggctcagaactgagaatcac 372
           || |||||||| ||||| ||  ||||||| | ||||||||||
Sbjct: 341 gagctctggtcacaggtggtttggctcaggaatgagaatcac 382


>gnl|LJGI|TC78151 homologue to UniRef100_Q0GPF8 Cluster: BZIP transcription factor
           bZIP124; n=1; Glycine max|Rep: BZIP transcription factor
           bZIP124 - Glycine max (Soybean), partial (71%)
          Length = 1385

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 307 atgaggaagcagaagcacttggatga 332
           ||||||||||||||||||||||||||
Sbjct: 550 atgaggaagcagaagcacttggatga 575