Miyakogusa Predicted Gene

Lj0g3v0246449.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0246449.1 Non Chatacterized Hit- tr|I1K063|I1K063_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,43.43,1e-17,Aa_trans,Amino acid transporter,
transmembrane,gene.g19209.t1.1
         (471 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC597100 similar to UniRef100_P92961 Cluster: Proline t...   238   3e-62

>gnl|LJGI|DC597100 similar to UniRef100_P92961 Cluster: Proline transporter 1; n=1;
           Arabidopsis thaliana|Rep: Proline transporter 1 -
           Arabidopsis thaliana (Mouse-ear cress), partial (38%)
          Length = 566

 Score =  238 bits (120), Expect = 3e-62
 Identities = 270/320 (84%)
 Strand = Plus / Plus

                                                                       
Query: 145 gattcatggtttcaagtggggtttgtgctcaccactggaatcaacagtgcttatgtgctt 204
           ||||||||||| || ||||  |||||||||||||| ||| ||||||||||||||||||||
Sbjct: 90  gattcatggttgcaggtggcttttgtgctcaccaccggagtcaacagtgcttatgtgctt 149

                                                                       
Query: 205 ggatattcagggaccatcatggttccactgggttggatagggggtgtggtggggttagtt 264
           |||||||| || ||| |||||||||| ||||||||||  || || || || ||  |  ||
Sbjct: 150 ggatattccggcaccgtcatggttccgctgggttggaccggcggcgtagttggtctgctt 209

                                                                       
Query: 265 tttgccactgcaatatccctctatgcaaatgctcttattgctatgcttcatgaatatgga 324
            ||||   || |||||| ||||||||||||| |||| |||| | ||| ||||||||||||
Sbjct: 210 cttgcttgtggaatatcactctatgcaaatgttcttgttgccaggctccatgaatatgga 269

                                                                       
Query: 325 ggcacaaggcatattagatacagagatcttgctggttatatatatggtagaaaagcatat 384
           || | |||||| |||||||||||||||||||||||||  ||||||||||| |||||||||
Sbjct: 270 gggaaaaggcacattagatacagagatcttgctggtttcatatatggtaggaaagcatat 329

                                                                       
Query: 385 gccctcacatggactctgcagtacgtcaatcttttcatgataaatgccggatacatcatt 444
            | ||||| ||| ||||||||||  |||||||||||||||||||| | || | ||||| |
Sbjct: 330 tctctcacttgggctctgcagtatatcaatcttttcatgataaatactggcttcatcagt 389

                               
Query: 445 ttggctggttctgctttgaa 464
           ||||||||||| || |||||
Sbjct: 390 ttggctggttcagccttgaa 409