Miyakogusa Predicted Gene

Lj0g3v0241899.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0241899.1 tr|Q6BE26|Q6BE26_CITUN Somatic embryogenesis
receptor kinase 1 OS=Citrus unshiu GN=SERK PE=2
SV=1,85.71,1e-17,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL,CUFF.15809.1
         (228 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic ...    70   6e-12
gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic ...    66   1e-10

>gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic embryogenesis
           receptor kinase; n=1; Capsicum chinense|Rep: Somatic
           embryogenesis receptor kinase - Capsicum chinense
           (Scotch bonnet) (Bonnet pepper), partial (52%)
          Length = 488

 Score = 69.9 bits (35), Expect = 6e-12
 Identities = 72/83 (86%), Gaps = 1/83 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  ataatggttccttcgcattattcactcctataagttttgc-aaacaacttggatctgtgt 132
           ||||||| |||||| |||||||||||||||| |||||| |  || ||||||||||| |||
Sbjct: 6   ataatggctccttctcattattcactcctatcagttttactcaataacttggatctatgt 65

                                  
Query: 133 ggaccagtcactgggaacccttg 155
           || || ||||||||| |||||||
Sbjct: 66  ggccctgtcactgggcacccttg 88


>gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
           embryogenesis receptor kinase 1 - Medicago truncatula
           (Barrel medic), partial (25%)
          Length = 852

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 23  ctctccaagttctggatttgtctaataaccgtctctc 59
           |||||||||| ||||||||||||||||||||||||||
Sbjct: 816 ctctccaagtgctggatttgtctaataaccgtctctc 852