Miyakogusa Predicted Gene

Lj0g3v0241359.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0241359.1 Non Chatacterized Hit- tr|I3SEM2|I3SEM2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,91.67,0.00000000009,seg,NULL,CUFF.15766.1
         (163 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57703 similar to UniRef100_Q0PGF2 Cluster: Molecular ...   184   1e-46
gnl|LJGI|TC57264 homologue to UniRef100_Q9SWB5 Cluster: Seed mat...   184   1e-46
gnl|LJGI|TC59787 homologue to UniRef100_Q9SWB5 Cluster: Seed mat...    72   1e-12

>gnl|LJGI|TC57703 similar to UniRef100_Q0PGF2 Cluster: Molecular chaperone; n=1;
           Ricinus communis|Rep: Molecular chaperone - Ricinus
           communis (Castor bean), partial (74%)
          Length = 1050

 Score =  184 bits (93), Expect = 1e-46
 Identities = 96/97 (98%)
 Strand = Plus / Plus

                                                                       
Query: 41  gggatatcgtgtttgtgcttcagttgaaggaacaccccaaattcaaaagaaaggctgaag 100
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 838 gggatatcgtgtttgtgcttcaattgaaggaacaccccaaattcaaaagaaaggctgaag 897

                                                
Query: 101 acctctttgtggagcacaccctgtccctcactgaggc 137
           |||||||||||||||||||||||||||||||||||||
Sbjct: 898 acctctttgtggagcacaccctgtccctcactgaggc 934


>gnl|LJGI|TC57264 homologue to UniRef100_Q9SWB5 Cluster: Seed maturation protein
           PM37; n=1; Glycine max|Rep: Seed maturation protein PM37
           - Glycine max (Soybean), partial (57%)
          Length = 918

 Score =  184 bits (93), Expect = 1e-46
 Identities = 96/97 (98%)
 Strand = Plus / Plus

                                                                       
Query: 41  gggatatcgtgtttgtgcttcagttgaaggaacaccccaaattcaaaagaaaggctgaag 100
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 219 gggatatcgtgtttgtgcttcaattgaaggaacaccccaaattcaaaagaaaggctgaag 278

                                                
Query: 101 acctctttgtggagcacaccctgtccctcactgaggc 137
           |||||||||||||||||||||||||||||||||||||
Sbjct: 279 acctctttgtggagcacaccctgtccctcactgaggc 315


>gnl|LJGI|TC59787 homologue to UniRef100_Q9SWB5 Cluster: Seed maturation protein
           PM37; n=1; Glycine max|Rep: Seed maturation protein PM37
           - Glycine max (Soybean), complete
          Length = 1671

 Score = 71.9 bits (36), Expect = 1e-12
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 66  gaaggaacaccccaaattcaaaagaaaggctgaagacctctttgtggagcacaccctgtc 125
           ||||||||| ||||| |||||||||||| ||||||| || ||||| ||||||||  ||||
Sbjct: 921 gaaggaacatcccaagttcaaaagaaagtctgaagatctttttgttgagcacactttgtc 980

                       
Query: 126 cctcactgaggc 137
           ||| ||||||||
Sbjct: 981 cctaactgaggc 992